Драка ефременковой и донцовой: Непримиримые враги стали друзьями?

Содержание

Между Юлией Ефременковой и Маей Донцовой разгорелся очередной скандал

Участницы «Дома-2» Юлия Ефременкова и Майя Донцова вновь схлестнулись в совестной перепалке и чуть не довели дело до драки.

В свое время попытки Маи Донцовой обличить Юлию Ефременкову закончились жесткой потасовкой. Тогда Донцова сочла постыдные фотографии из прошлого Ефременковой настоящей продажностью, и конечно же сообщила об этом во всеуслышание, за что и получила от Юлии по полной программе.

Не отказалась Мая от своих слов и на импровизированном ринге в городских квартирах, и лишь чудом не лишившись недавно наращенных волос, которая ей чуть не повыдергивала Ефременкова.

Глядя на недовольное лицо Юлии, готовой кинуться на свою обидчицу, ведущему «Дома-2» Владу Кадони пришлось напомнить участницам реалити-шоу, что драться на ринге строго запрещено, а все взаимные недовольства и споры следует решать мирно.

Ефременкова, конечно же согласилась с ведущим, но зрители считают, что это не надолго. Только девушки окажутся на Поляне Юлия обязательно отомстит Мае.
По материалам: dni24

Загрузка...

Ведущие «Дома-2» озвучили интимные проблемы Юлии Ефременковой и Сергея Кучерова

Интимные проблемы участников «Дома-2» Сергея Кучерова и Юлии Ефременковой из-за ведущих проекта стали достоянием общественности. Как ни старались Сергей Кучеров и Юлия Ефременкова убедить коллектив в серьезности своих отношений и намерений к друг другу, их ссоры, а в последнее время и рукоприкладство, говорят совсем об обратном. Помочь паре разобраться в проблемах в их взаимоотношениях поспешили ведущие. Правда ... ПОДРОБНЕЕ →

Юлия Ефременкова уверена, что она и Сергей Кучеров победят в "Любви года"

Одна из самых скандальных участниц телепроекта "Дом-2" Юлия Ефременкова, которая встречается с Сергеем Кучеровым, считает, что именно их пара одержит победу в конкурсе "Любовь года", так как им просто нет равных. Как теперь известно, девушка всегда следит за тем, как зрители оценивают шансы их пары, и отлично понимает, что большинство фолловеров на их стороне. По словам импульсивной брюнетки, если в ходе конкурса ... ПОДРОБНЕЕ →

Сергей Кучеров встанет перед родственниками Юлии Ефременковой на колени

Из-за того, что случилось недавно с Сергеем Кучеровым и Юлией Ефременковой, родственникам девушки пришлось сильно поволноваться. Накануне произошёл инцидент, который поставил на уши всё сообщество "Дома-2". Во время вспыхнувшего очередного конфликта Сергей Кучеров сильно толкнул свою возлюбленную Юлию Ефременкову, которая сильно ударилась об лестницу. Зрители были возмущены поступком габаритного мужчины, применившим ... ПОДРОБНЕЕ →

Сергей Кучеров рассказал о конфликте с Юлией Ефременковой

Сергей Кучеров прокомментировал разгоревшийся на почве темы измен конфликт со своей возлюбленной Юлией Ефременковой. Звезда реалити-шоу "Дом-2" Сергей Кучеров уверяет, что всего один раз изменил своей второй половинке, в чём очень сильно раскаялся, ведь, по его словам, он чувствует, что Юля - идеальная девушка для него. Сама же Ефременкова уверена: измен со стороны Сергея было намного больше чем одна. По этому ... ПОДРОБНЕЕ →

Участница Дома-2 Юля Ефременкова указала ведущей Бузовой на ее место

Все мы помним, что ведущая реалити-шоу «Дом-2» Ольга Бузова после развода начала музыкальную карьеру. И это несмотря на то, что у девушки нет вокальных данных. Поклонники телепроекта считают, что, например, одна из его участниц поет намного лучше, чем Бузова. В пример Ольге поставили Юлю Ефременкову. Многим поклонникам этой передачи понравилось пение Юлии. Зрители считают, что это Ефременковой надо заниматься ... ПОДРОБНЕЕ →

Дом-2. Новости / Что осталось за кадром финала конкурса «Любовь года»

В борьбе за главный приз улыбки героев телепроекта сменяли слезы разочарования. Журнал «ДОМ−2» собрал ключевые моменты записи финала конкурса и решил рассказать о том, чего не увидит зритель.

В конурсе «Любовь года» принимали участие самые яркие пары проекта
​Фото: «Инстаграм»

Конкурс стал одним из самых тяжелых испытаний для участников проекта «ДОМ−2». За победу боролись 12 пар, до финала дошли самые стойкие: Никита Кузнецов и Дарина Маркина, Сергей Кучеров и Юлия Ефременкова, Захар Саленко и Лера Фрост. Несколько месяцев ребята на глазах у миллионной аудитории проходили серьезные испытания, ссорились, мирились, терпели нападки конкурентов и пытались доказать искренность чувств, чтобы получить ключи от квартиры в ЖК Город-курорт «Май».

 «А что вы так все переживаете? — спросила Юлия Ефременкова, появившись на площадке. — Понятно же, что победит Никита. Я слышала, как он с Дариной уже обсуждал, какую стенку можно снести в квартире и что там переделать».

Юлия разочарована результатами конкурса
​Фото: Кадр программы

30-летняя Юлия Ефременкова потеряла всякий интерес к происходящему уже через пару часов. Девушка давно перестала обновлять страничку голосования зрителей.

 «У нас с Сережей яркие отношения, через что только не прошли, — продолжает Ефременкова. –Даже после драки наши рейтинги не падали, а перед финалом внезапно в лидерах оказался спокойный и довольный жизнью Никита и постоянно молчащая, хлопающая глазами Дарина».

Но без камер «образцовой» паре, как оказалось, было что обсудить. Финальным испытанием перед оглашением результатов стал детектор лжи для девушек. Журнал «ДОМ−2» стал свидетелем разговора Дарины и Никиты. Эффектная блондинка была явно напугана, ее буквально трясло от страха.

«Ты же понимаешь, что они сделают, — со слезами на глазах шептала Дарина Кузнецову. — Этот детектор покажет все по-другому». 

Никита и Дарина выиграли квартиру
​​Фото: Кадр программы

Но на истерику возлюбленной мужчина отреагировал спокойно. Взяв ее за руки, Никита объяснил, что волноваться ей не о чем. «Дарин, все будет хорошо. Я верю тебе, и не так важно, что покажет детектор!»

Свет, камера, мотор. Полиграфолог настроил оборудование, ведущие принялись оглашать список участниц, которым предстоит испытать себя на полиграфе… Только вот имя Дарины Маркиной в очереди на тестирование так и не прозвучало. «Дарина постоянно с Никитой, даже на выездах, — заявила ведущая Ксения Бородина. — Нам нечего у нее спрашивать».

После съемки возмущению женской части коллектива не было предела. Мария Кохно, Майя Донцова и Юля Ефременкова отошли в сторону, чтобы обсудить произошедшее. Девушки искренне не понимали, почему для Маркиной, по их мнению, создаются особые условия.

«Дарина знала о детекторе заранее, — утверждает одна из участниц. — На поляне сегодня слышала, как она говорила об этом. Что тут вообще происходит?»

Накал страстей на площадке был таким, что многие попросту не выдерживали и срывались. От разочарования в конкурсе Юлия Ефременкова едва сдерживала слезы и даже задумалась об уходе с проекта.

«Я больше переживаю, не за квартиру. Жила без нее и проживу еще,- заявляет брюнетка. — Мы с Сережей сами купим, никому ничего не доказывая. Честно, у меня опустились руки».

Юлия Ефременкова и Сергей Кучеров
​Фото: «Инстаграм»

Другие финалисты конкурса, Лера Фрост и Захар Саленко, похоже, чувствовали себя расслабленно и даже не переживали. Не так давно между влюбленными произошла серьезная ссора, сопровождавшаяся истериками и драками. Громкий скандал пошел на пользу паре — после примирения они буквально неразлучны. Ребята не отходили друг от друга ни на шаг, делали совместные фото, целовались и исполняли медленный танец под хит Григория Лепса «Рюмка водки на столе».

«Эта ссора нас сблизила, — заявляет Захар. — Ни капли не жалею, что случилось именно так. Просто за этот небольшой период мы действительно осознали, что значим друг для друга».

А вот 23-летняя Фрост заявила, что в разгар ссоры хотела поцеловать любимого. «Мы потом признались друг другу, что ненависть и страсть были на одинаковом уровне, — поделилась участница. — Тогда желали разорвать одежду и окунаться друг в друге, но, наверное, нас сдержали камеры».

Фрост и Саленко не расстроились из-за конкурса
​Фото: «Инстаграм»

Юлия Ефременкова – биография, фото, личная жизнь, новости, «Дом-2» 2018

Юлия Ефременкова: биография

На многих интернет-сайтах говорится, что Юля Ефременкова с детства поставила себе цель стать известной личностью и может похвастаться насыщенной биографией. Девушка участвовала в шоу Константина Меладзе «Хочу в ВИА Гру» и дошла до финала. Затем попробовала силы в экстремальном проекте «Дикие игры», проводимом телеканалом СТС.

Юлия Ефременкова в 2018 году

В определенной степени добившись узнаваемости, побывала замужем за популярным актером Тимуром Ефременковым, звездой спортивных фильмов «Чемпионы» и «Легенда №17». Добавил известности и «Дом 2», где яркая брюнетка переквалифицировалась из участницы в ведущую.

Детство и юность

Юля Кириенко родилась в жарком южном Туапсе в апреле 1987-го. О родителях девочки в Сети информация разнообразная. Слухи и домыслы развеяла сама Юля, опубликовав пост в «Инстаграме». Согласно ему, мамой она называла бабушку. Биологические родители работали на Севере, а поскольку дочь болела, взять малышку с собой не могли. Заботы о воспитании легли на плечи бабушки.

Юлия Ефременкова

Когда родители вернулись, девочке было уже 2 года. Чтобы не травмировать психику ребенка, оставили все как есть, и родную маму Юля называла по имени – Елена. Мать позднее умерла от воспаления легких, а отец еще раньше ушел из семьи. Бабушка, как пишет участница шоу в комментариях под фото в социальной сети, остается главным человеком в ее жизни.

С пяти лет Юля увлеклась пением, через 3 года начала выступать на сцене, участвовала в различных городских мероприятиях. Уже в 12 лет юная певица записала первый диск. Переехав в Краснодар, поступила в музыкальное училище, которое с успехом окончила и пошла работать по специальности.

Юлия Ефременкова в детстве

По слухам, первым местом работы Юли стал местный ночной клуб. Там же девушка познакомилась с будущим мужем, с которым переехала в Москву. В столице Ефременкова с новой силой принялась совершенствовать вокал, пела в диско-группе «Диамант», в 2013-м по совету подруги пришла на кастинг в новую «ВИА Гру».

Во время участия в музыкальном реалити девушка обзавелась массой поклонников на малой родине, а также приобрела бесценный опыт выживания. По словам Юли, репетировать приходилось по ночам, а хореографические номера больше напоминали цирковые трюки.

Юлия Ефременкова в шоу «Хочу в ВИА Гру»

Кроме того, у бывшей участницы сложилось впечатление, что на конкурсе «вытягивали» конкретных людей. Прямой наставницей Ефременковой была Альбина Джанабаева, Меладзе тоже частенько давал советы, интересовался, как работается.

На проекте девушка заболела, охрипла, и попросту ушла бы, если бы не поддержка бабушки и мужа. Перед решающим концертом петь совсем не могла. Почему в итоге она не победила, Юля не рассказывала. Заметила только, что благодарна этому шоу хотя бы за то, что примерила роль звезды.

«Дом-2»

Прийти на телестройку «Дом-2» Ефременкова решилась, когда в клубе, где она работала, увидела участника шоу Глеба Жемчугова. В декабре 2016-го состоялся приход Юлии, и объектом своего внимания девушка избрала как раз Глеба. По другой, также неподтвержденной информации, Юля получила приглашение принять участие в реалити еще во время конкурса Константина Меладзе.

Юлия Ефременкова и Глеб Жемчугов

Поначалу на шоу девушка позиционировала себя как ревностного блюстителя нравственности, осуждала тех, кто не вписывался в принятые ею рамки морали. Так продолжалось до тех пор, пока в Сети не всплыли фото и видео скабрезного содержания, а изображенная там блондинка походила на Юлию.

Часть зрителей немедленно потребовала удалить обманщицу из шоу, однако Ефременкова не только не покинула площадку, но и из рядовой участницы превратилась в ведущую реалити.

Юлия Ефременкова и Сергей Захарьяш

С Глебом Клубничкой, как и со следующим претендентом Сергеем Захарьяшем, отношения не сложились. Первый уже обрел вторую половинку, а второй в конце концов заявил, что отправляется на Сейшелы к другой участнице.

Следующим ухажером знойной брюнетки стал Сергей Кучеров. Ефременкова разглядела в брутальном мачо мягкий характер, привлекло и то, что мужчина не попрекал Юлю ее прошлым. Пара одно время лидировала в конкурсе «Любовь года» и, несмотря на кучу слухов и разногласий, держалась вместе, со временем попав в топ участников.

Юлия Ефременкова и Сергей Кучеров

Еще в январе 2018-го, по словам Юлии, Сергей высказал пожелание уйти с проекта. Девушка поинтересовалась мнением поклонников, что же делать дальше. Одни посчитали, что молодым людям делать нечего в реалити, поскольку они уже обрели счастье. Другие высказались в том плане, что такие заявления – всего лишь попытка Ефременковой заработать рейтинги.

Личная жизнь

С актером Тимуром Ефременковым Юлия четыре года прожила в гражданском браке, прежде чем оформить отношения официально. Пара участвовала в семейном развлекательном шоу «Дикие игры», завела собаку – йоркширского терьера Милену и в такой компании много путешествовала.

Юлия Ефременкова и Тимур Ефременков

В 2016-м супруги развелись, по словам Юлии, инициатива принадлежала ей. Что послужило основанием для расторжения брака, ни одна из сторон не сказала. Бывшие муж и жена сохранили дружеские отношения, созваниваются. Тимур шутит, что, как воскресный папа, раз в неделю навещает собаку, которую Юля забрала с собой.

Юлия Ефременкова до и после пластики

Фолловеры Ефременковой полагают, что новая ведущая «Дома-2» по традиции не избежала стороннего вмешательства во внешность, в частности, акцентируют внимание на «подкачанных» бюсте и губах. Впрочем, сама Юля утверждает, что ее красота естественная, но в пластике нет ничего плохо, если делать в меру.

Юлия Ефременкова сейчас

В 2018-м одежный бренд O’STIN и женский интернет-журнал Woman.ru организовали «стильную битву» популярных влогеров, во время которой они делились секретами составления модного гардероба. Юлия Ефременкова участвовала в проекте вместе с Майей Донцовой, еще одной участницей «Дома-2». «Заклятые подруги» до этого уже сходились в стычках на телестройке, особенно запомнилась зрителям драка, когда девушек разнимали пять парней.

Юлия Ефременкова и Майя Донцова

Шоу, подобные «Стилю за 90 секунд», полезны для тех, кто старается не отставать от моды, но не успевает ходить по магазинам или модным показам, говорит Юля. Как большинство женщин, Юля любит красивые вещи и от участия в конкурсе получила незабываемое удовольствие. При этом заметила, что не боится проиграть, ведь у людей вкусы не совпадают, и услышать разные точки зрения об одной и той же вещи будет полезно.

Появление Юлии в «Доме-2» в новом статусе далеко не всем пришлось по душе. Одним не нравится голос новой ведущей, другим – отношение к остальным участникам и в целом поведение девушки. Нашлись и те, кто восторгается «служебным повышением» любимицы.

Фото

Post Views: 95

биография топовой участницы и ведущей телепроекта "Дом-2"

.

Красивая девушка, карьеристка, которая с самого детства привыкла добиваться всего сама — Юлия Ефременкова, ведущая из Дом-2. Тяжёлое детство закалило девушку и сформировало её характер. В 2021 она одна из самых красивых женщин России в ТОП-100 по версии журнала «Максим».

Смотреть все фотографии

Юлия Ефременкова
Настоящее имя:Юлия Ефременкова (в девичестве Кириенко)
Никнейм:Нет
Сфера деятельности:Телеведущая, модель
Дата рождения:2 апреля 1987 г.
Место рождения:Россия, Туапсе, Краснодарский край, живет в Москве
Знак Зодиака:Овен
Знак восточного гороскопа:Кролик
Национальность:Русская
Семейное положение:Разведена. Бывший муж Тимур Ефременков
Социальные сети Другие социальные сети

Биография ведущей

Юлия с самого детства шла к карьере артистки. В 14 лет было принято решение переехать в Краснодар, и уже там она окончила среднюю школу и получила аттестат. Девушка с лёгкостью поступила в музыкальное училище. После окончания учёбы переехала в столицу.

Детство и юность

Родилась Юлия в Краснодарском крае в Туапсе. Воспитанием ребёнка занималась бабушка. Мама и папа работали на Севере и не могли взять её с собой. Когда родители вернулись с вахты, детская психика ребёнка так и не смогла принять сложившуюся ситуацию. И взрослые приняли решение оставить всё как есть. Биологических родителей Юля называла по имени, и даже когда они ушли из её жизни, она ничего не потеряла. Бабушка так и осталась самым близким и родным человеком для девушки.

С 5 лет Ефременкова занималась вокалом, с 8 выступала на сцене. В 12 был записан первый диск, который принёс известность девочке. Её стали приглашать на всевозможные городские мероприятия и праздники.

Путь к популярности

Профессиональная певческая карьера Юлии началась в 2008 г. в составе женской группы «Диамант».

В 2013 г. девушка дошла до финальной точки в шоу «Хочу в ВИА Гру». Опыт, приобретенный во время этой борьбы «за место под солнцем», Ефременкова считает очень ценным. Она увидела «изнанку» шоу-бизнеса и поняла главные правила выживания в нём.

Телевизионные эфиры песенного проекта были наполнены негативными эмоциями и практически «военными действиями» между девочками. В 2015 году Юлия была приглашена на семейное реалити-шоу «Дикие игры». Трансляция происходила на телеканале СТС. Вёл проект Тимур Родригез.

Первый успех

Познакомившись в клубе с Глебом Жемчуговым, девушка приняла решение стать участницей самого скандального шоу. В конце 2021 г. Юлия Ефременкова пришла на телепроект Дом-2. Изначально она выразила симпатию Глебу, но уже через 2 дня Жемчугов отказался от общения с девушкой, высказав в её адрес массу нелестных слов.

Красотка не растерялась и переключила свое внимание на самого спокойного участника проекта — Сергея Кучерова. Но даже с ним были скандалы, в интернете есть немало видео драк Юлии Ефременковой с парнем и девушками.

В конце 2021 г. продюсерский центр телеканала ТНТ предложил Юлии стать соведущей на воскресном шоу «Сплетницы». Перейдя в основной состав и став полноценной ведущей на телепроекте, Ефременкова получила славу и признание. Ни один пост, ни одно фото, выложенное в социальных сетях, не остается без внимания.

Настоящее и творческие планы на будущее

В 2021 г. Юлии было предложено сотрудничество с известным брендом OSTIN и женским журналом. Девушка должна была совместно со своей «заклятой» подругой Майей Донцовой вести битву вкусов и помогать девушкам в составлении своего индивидуального гардероба.

Поиск себя в творчестве

Юля не стала просто женой, ей хотелось построить собственную карьеру в шоу-бизнесе. Она начала выступать в коллективе «Диамант», исполняя с двумя другими девушками музыку в стиле диско. А в 2013 году попробовала свои силы в проекте К. Меладзе «Хочу в ВИА Гру». В многочисленных кастингах соревновались девушки из Казахстана, Украины, Беларуси и России. Из числа последних лишь две представительницы вышли в финальную часть конкурса, где Юлии удалось пройти три тура.

Период, проведенный в Киеве, она вспоминает как очень сложный. Приходилось репетировать ночами и выполнять на сцене настоящие акробатические трюки. Не став победительницей, Юлия все равно благодарна наставникам и лично К. Меладзе за возможность хоть на время почувствовать себя звездой.

Где еще до «Дома-2» можно было видеть Юлию Ефременкову (фото с проекта К. Меладзе есть в статье)? Вместе с Тимуром девушка появилась в шоу СТС «Дикие игры» в 2015 году, а на следующий год пара развелась.

Личная жизнь

Своё прошлое Юлия не скрывает и информация находится в открытом доступе. С бывшим мужем Тимуром Ефременковым Юлия познакомилась ещё в Краснодаре. Позже к нему она переехала в Москву. Молодые люди 4 года жили в гражданском браке, и только в 2012 г. состоялось бракосочетание.

В 2021 г. было принято обоюдное решение развестись. По словам Юлии, брак просто «изжил» себя. Молодые люди разошлись мирно, по-дружески.

После развода Ефременкова решила «строить любовь» на телепроекте Дом-2. Долго девушка металась между поклонниками, симпатиями.

  1. В 2021 г. Юлия попыталась строить отношения с Сергеем Захарьяшем, но парень отказал девушке.
  2. Потом был Сергей Кучеров. Парень даже сделал Ефременковой предложение руки и сердца, и она согласилась. Отношения молодых людей были похожи на качели. То взлёты, то падения. Сергей уходил с проекта, Юлия оставалась. Потом Кучеров вернулся и страсть вспыхнула вновь. В начале 2021 г. пара всё-таки распалась из-за абсолютно разных взглядов на жизнь и интересов.
  3. Весной 2021 вспыхнул новый не менее скандальный роман. Ефременкова приняла ухаживания горячего парня — Мондезира Свет-Амура. В отношениях молодых людей было всё: ссоры, страсть, конфликты, примирение.

Юлия Ефременкова и Мондезир Свет-Амур

Вокруг свежеиспечённой пары ходит масса слухов. Поклонники заметили, что у Ефременковой округлился живот, сразу разлетелась по социальным сетям информация о беременности девушки.

Личная жизнь Юлии Ефреминковой до телепроекта Дом-2

На одной из вечеринон в ночном клубе, Юлия познакомилась со своим будущим мужем Тимуром Ефреминковым. У молодых людей закрутился бурный роман, после чего Тимур увез Юлию в Москву. После трех лет совместной жизни в столице, Тимур Ефреминков сделал предложение Юлии. Влюбленная пара сыграла пышную свадьбу. В Москве у Юлии было намного больше возможностей реализоваться как артистке. Девушка посещала всевозможные музыкальные кастинги. В итоге Юлия Ефреминкова попадает на проект «Хочу в Виагру». Там ей удалось дойти до финала, но к сожаления девушка не смогла одержать победу. После участия в проекте, Юля стала очень популярна в социальных сетях. Инстаграм Юлии Ефреминковой начал набирать популярность. Девушке стала поступать множество предложений о работе. Юлия Ефреминкова и Тимур строили карьеру, на семью у пары не было времени. Они все реже проводили вместе время и практически не интересовались жизнью друг друга. В итоге, чувства друг к другу у Юлии и Тимура остыли, и в 2021 году они развелись.

Внешность

Раньше ходили слухи, что Ефременкова эскортница, но если посмотреть на фото прошлых лет, то вряд ли услуги её сопровождения стоили дорого, выглядела девушка плохо.

Судя по фотографиям, находящимся в открытом доступе, рука пластического хирурга участвовала в создании образа Юлии Ефременковой. Девушка категорически отрицает этот факт, но сравнительный анализ фотографий до проекта и сейчас — явное подтверждение вмешательства. Раньше её фотографии без макияжа приводили людей в откровенный ужас, но сейчас ситуация совсем иная. Лицо стало намного ухоженнее и свежее, изменилось очень многое в очертаниях, они стали более женственными.

Рост164 см
Вес61 кг
Цвет глазЗеленый
Цвет волосБрюнетка от природы. Часто экспериментирует с новыми цветами и тонами
ТатуировкиСудя по фотографиям в стиле «ню», татуировок на теле девушки нет
Пластические операцииСо слов самой девушки их не было. Но не видит ничего плохого в пластике. Главное, чтобы все мероприятия проводились в меру. Если сравнить фото до и после пластики, то видны: ринопластика, увеличение губ филлерами, блефаропластика и липосакция подбородка. Также девушка сделала себе виниры на зубах.

Внешность Юлии Ефременковой

Никита Кузнецов и Дарина Маркина совершенно спокойно выстраивают свое счастье

Последние новости телепроекта «Дом-2″, которые актуальны на сегодняшний день, 20 августа, передают информацию о следующей череде событий: Никита Кузнецов и Дарина Маркина совершенно спокойно выстраивают свое счастье. Майя Донцова повторяет путь Либерж Кпадону. Сергей Кучеров признался, что не чувствует ласки и теплоты со стороны Юлии Ефременковой.

— Едва Ирина Михайловна покинула телепроект, как ее труды по устройству личной жизни своей дочери Майи потерпели фиаско, ведь буквально спустя несколько дней после ее ухода, Алексей Купин принял решение расстаться с Майей. И хотя в случившемся в большей степени виновата сама девушка, ее мама склонна винить и коллектив. Именно претензии к участникам «Дома-2″ стали для Донцовой-старшей поводом вернуться в Периметр, чтобы устроить разборки неугодным ей домовцам. По словам Сергея Кучерова, чтобы выглядеть убедительнее и решительнее, Ирина Михайловна позволила себе выпить спиртного. К слову, отстоять дочь Донцовой-старше вряд ли удалось. По крайней мере Майя до сих пор является главным кандидатом на голосовании, да и Леша не спешит ее прощать. Поэтому все главные испытания для Майи ждут ее впереди.

— Никита Кузнецов поведал о построении личного счастья с Дариной Маркиной.

«Мы с Дариной прекрасно осознаем, что в рамках шоу нашу пару нельзя назвать самой яркой или самой интересной. Мы мало скандалим, у нас происходит мало ругани, нет драк и измен. Мы просто строим свое тихое счастье и радуемся друг другу. Я не готов променять это счастье ни на шоу, ни на конкурс. Не собираюсь ради этого устраивать конфликтные ситуации, драться и ругаться. Это не так важно. Намного важнее, что я встретил человека, с которым я смотрю в будущее, в котором я уверен, с которым в скором времени создам семью. Я не призываю вас голосовать за нашу пару, я призываю вас смотреть реально на вещи и думать, что вы хотите поддержать: настоящие искренние чувства или экшн, это ваш выбор. Говорить про другие пары плохо я тоже не хочу, каждый стремится к победе, хочет быть лучшим и выиграть приз, у всех свои отношения, свой характер», — пояснил Никита.

— Сергей Кучеров совершенно не чувствует тепла от Юлии Ефременковой.

«Юля часто говорит о проявлении любви и нежности, но, несмотря на то, что мы уже 6 месяцев вместе, ни ласки ни тепла я от нее не чувствую. Разговоры разговорами, но по факту действий никаких. Даже элементарное объятие случается редко. Два раза в день обнять это прям пик ее нежности! И то, только если у нее настроение хорошее, чего практически не бывает. А так, в целом она закрытая и постоянно находится в себе, ее многое тревожит. Например, какие-то мои действия, которые я совершал ранее, хотя мы уже давно забыли и прошли. Но Юля возвращается к темам, которые мы закрыли снова и снова, переживает их, поэтому находится в диком напряжении и мрачных размышлениях», — сообщил парень.

— Либерж Кпадону вне всякого сомнения входит в число самых рейтинговых и узнаваемых участниц, когда-либо пребывавших в «Доме-2″. Однако такая популярность не дается просто так и мулатке сполна пришлось заплатить цену за свои рейтинги.

Так, наверняка многие помнят, что Либи неоднократно сталкивалась с издевательствами в свой адрес, когда ей приписывали алкогольную зависимость в то время, когда ее коллеги по молодёжному телешоу гораздо чаще и очевиднее позволяли себя выпить. Судя по последним эфирам, подобный сценарий организаторы решили повторить на другой участнице — Майе Донцовой. Также как в свое время за Либерж, за гулянками Донцовой теперь пристально следят не только участники, но и ведущие. Причем, как первые, так и вторые, готовы ежедневно обличать «пьянки» девушки, закрывая глаза на загулы остальных.

Звезду «Дома-2″ умоляют показать сына врачам

Бывшая участница телестройки Евгения Феофилактова серьезно обеспокоила своих поклонников, выложив видео с сыном. Люди просят Женю срочно отвести мальчика к медикам.

Дело в том, что на записи едва можно разобрать, что говорит пятилетний мальчик. Малыш не только путает слова, но и очень плохо выговаривает их. Подписчики считают, что для пятилетнего ребенка такое не допустимо.

«Проснись, женщина! Вместо того, что бы фотать бесконечно и снимать видео с сыном, отведи его к неврологу и логопеду. Ему уже 4, а такая каша во рту. Он уже не разболтается, становление речи и звукообразование проходит до 3х лет! Пойми, что дальше будет только хуже, а в школе ребенок на этом фоне и читать хуже будет, и писать. Займись его речью», – написала Феофилактовой одна из подписчиц (орфография и пунктуация авторов здесь и далее сохранены – прим.ред.).

Другие же обратили внимание на суть разговора мальчика с мамой.

«Когда вырасту я буду жить с ней (имеется в виду некая девочка – прим.ред.) и с тобой. А если она будет против, я ее выгну (видимо, малыш имел ввиду выгоню – прим.ред.)», – заявил сын Феофилактовой, чем просто обескуражил общественность.

Фанатки тут же рекомендовали Жене отвести сына к психологу. «Мальчик превратившись в мужчину создает свою семью , а не остается с мамой. Таким образом появляются»маменькины сынки» и в это не дети виноваты ,а их родители. Которые не научили своего сына нести ответственность… «Правильно из за какой то девчонки маму менять» . Маму менять не надо. Но жить нужно отдельно», – категорично высказалась одна из поклонниц звезды телестройки.

Собака юлии ефременковой


Юлия Ефременкова: фото, биография, фильмография, новости

Певица, участница и ведущая реалити-шоу «Дом-2» на канале ТНТ.

Биография

Юлия Ефременкова (в девичестве Кириенко) родилась в Туапсе 2 апреля 1987 года. Когда ей было пять лет, начала заниматься вокалом, а с восьми лет уже профессионально выступала на сцене. В 12 лет Кириенко записала свой первый диск. Среднюю школу и музыкальное училище девушка окончила не в родном Туапсе, а в Краснодаре, куда семья Юли переехала, когда ей было 14 лет. Спустя года Юлия Ефременкова сообщила, что сильно переживала из-за расставания родителей и того, что ее отец женился на другой женщине. Выяснилось, что отец бросил мать Юли, когда дочери было всего шесть лет.

В Краснодаре девушка познакомилась со своим будущим супругом Тимуром, с которым уехала в Москву. В 2012 году начинающая певица Юлия Кириенко вышла замуж за актера Тимура Ефременкова («Проклятый рай», «Меч», «Миндальный привкус любви», «Легенда №17») и сменила фамилию на фамилию мужа. В Москве Юля начала выступать в трио « Диамант»: три симпатичные солистки исполняли песни в стиле диско. В 2013 году Ефременкова прошла кастинг в шоу «Хочу в Виагру» и дошла до третьего тура. Кроме того, в 2015 году Юлия вместе с мужем принимала участие в семейном развлекательном шоу «Дикие игры» на канале СТС, ведущим которого был шоумен Тимур Родригез.

В 2016 году Юлия и Тимур развелись. Тимур успешно снимается в фильмах, сериалах и говорит о том, что с экс-женой у него прекрасные, дружеские отношения. Его слова подтверждала у себя на странице в соцсетях и Юлия, которая написала о Тимуре как о человеке, который много для нее сделал и навсегда останется родным.

Юлия Ефременкова о разводе с мужем: «Решение разойтись было чётким и осознанным, мы не остались врагами, у нас нет друг к другу претензий, у нас никто не предавал и не уходил к другому (другой)… Просто время идёт, люди меняются… И я за честность!.. Я люблю своего бывшего мужа прежде всего как личность, я всегда буду рядом, если ему будет нужна моя помощь и поддержка, он замечательный человек...»

Юлия Ефременкова в реалити-шоу Дом 2

10 декабря 2016 года Юлия Ефременкова пришла на телепроект «Дом-2». Девушка выразила симпатию Глебу Жемчугову. Однако уже спустя пару дней после знакомства Глеб от неё отказался, назвав злобной хабалистой теткой. Юля обратила внимание на Сергея Захарьяша, однако построить отношения у них не вышло. Парень заявил, что хочет отправиться на Остров любви, чтобы быть с Лизой Полыгаловой.

Следующим избранником Юлии Ефременковой на проекте стал Сергей Кучеров. Молодой человек стал ухаживать за яркой брюнеткой, а ее в свою очередь привлек покладистый и спокойный характер Сергея. Кучеров даже сделал Ефременковой предложение руки и сердца, на которое она ответила согласием. Позже мужчина покинул телестройку, а Юлия продолжила строить карьеру ведущей. Разница в статусе влюбленных не смутила и роман вспыхнул с новой силой. В определенный момент Ефременкова даже призналась, что готова стать матерью.

Осенью 2017 года Юлия Ефременкова дебютировала в новом для себя амплуа: она стала одной из ведущих реалити-шоу «Дом-2». Так, Ефременкова была приглашена в воскресный выпуск «Сплетниц», который вела вместе с Ксенией Бородиной.

В начале февраля 2019-го Юлия Ефременкова окончательно рассталась с бывшим участником «Дома-2»  Сергеем Кучеровым. Как показало время, разные интересы и цели в жизни все же разрушили любовь. К слову, некоторые источники называют в качестве причины расставания Юлии и Сергея неверность Кучерова: молодой человек якобы не смог оправдаться после одной из измен, в которой его заподозрила возлюбленная.

В марте 2019-го Ефременкова начала встречаться с 30-летним участником телестройки Мондезиром Свет-Амуром. Мондезир долго ухаживал за телеведущей, одаривая ее мягкими игрушками и пышными букетами, и, в итоге, девушка сдалась. В паре царит идиллия, которая лишь иногда нарушается кратковременными ссорами. Вокруг пары постоянно циркулируют слухи, что они ждут ребенка или собираются пожениться, но молодые люди просят им не верить.

«Мне кажется, что у жизни есть такое понятие, как человек-шанс. Он даётся только oдин раз. Приходит для того, чтобы всё изменилось. Чтобы обнять твою душу. Чтoбы вылечить сердце. Чтoбы показать, что всё может быть иначе. Чтобы дать пoнять, что жизнь в которой ты варишься, мoжет быть совершенно другой. Жизнь однажды дарит такoго человека. У которого есть возможность вырвать тебя из негатива, из прoблем, из жизненных «пробок». И когда появляется такой человек, самое главное — не упустить егo, потому чтo, может быть, как раз он и является твоим пропуском в нoвую жизнь», — пишет о возлюбленном ведущая «Дома-2».

В декабре 2019-го стало известно, что Мондезир Свет-Амур сделал Юле предложение руки и сердца на концерте Ольги Бузовой. Юлия ответила согласием. Ольга Бузова посвятила возлюбленным песню «Я еще верю».

www.vokrug.tv

биография, личная жизнь, муж и дети

Юлия (Кириенко) Ефременкова – одна из самых ярких участниц телепроекта «Дом 2» сумела стать одной из ведущих канала ТНТ. Сегодня она преуспевающая шоу-дива, певица, модель. Эффектная внешность молодой артистки, а также артистические данные свидетельствуют о том, что ее ждет блестящая карьера в отечественном шоу-бизнесе.

Биографическая справка

Биография Юлии Ефременковой связана с двумя российскими городами. В южном Туапсе она родилась и выросла. В сердце России – Москве – она делает успешную карьеру на отечественном телевидении. О детстве восходящей звезды известно не очень много. Сама Юлия не любит вдаваться в подробности своего взросления и становления, родственники также не очень охотно дают интервью. Известно, что родители работали на Севере, а их дочь была на воспитании бабушки. Когда закончился рабочий контракт, Юлии исполнилось 2 года. Она воспринимала бабушку, как родную мать. Мама с папой не стали травмировать ребенка и оставили все как есть.


С бабушкой

Вскоре отец бросил их. Мать, которую Юлия называла по имени, умерла от пневмонии. Семья, как началась с двух человек – бабушки и внучки, таковой и осталась. Бабушка стала свидетельницей взросления внучки и ее становления, как артистки. С пяти лет девочка начала обучаться вокалу. За три года она достигла успехов, ее стали приглашать для участия в концертах. С 12-ти лет она начала записывать свои треки и даже выпустила первый альбом.

Юлия не особо задумывалась о будущей профессии. После школы она уезжает в Краснодар и без труда поступает в музыкальное училище. Через несколько лет перед дипломированным специалистом открываются новые перспективы. Но Юлия не идет преподавать в школу искусств и не открывает вокальный кружок при доме культуры. Ее манят огни большой сцены. Поэтому она устраивается вокалисткой в ночной клуб. Судьба сводит ее с Тимуров Ефременковым, за которого она выходит замуж. Амбициозная молодая пара уезжает покорять Москву.


Тимур и Юлия Ефременковы

Юлии повезло, ее взяли в качестве вокалистки в группу «Диамант». С подачи подруги она решила принять участие в кастинге «Хочу в ВИАгру». Она с легкостью проходит отборочный тур и под руководством Альбины Джанабаевой целенаправленно идет к финалу. Можно долго рассказывать, как обычная простуда повредила связки, голос. Одним словом, Юлии пришлось бы все равно уйти из проекта по состоянию здоровья. Но она билась до конца. Заболевший голос подвел, и она просто не прошла очередной тур.

В 2016 году после развода с Тимуром Юлия делает пластическую операцию и отправляется в шоу «Дом 2». В это время она работала в одном из московских ночных клубов. Там она познакомилась с Глебом Жемчуговым. Парень понравился, и девушка стала участницей скандального шоу. Юлия позиционировала себя, как единственный оплот нравственности в «Доме 2». Объектом ее симпатий оставался Глеб. Благодаря поведению у Юлии вскоре образовался круг поклонников. Но спустя какое-то время в сети появились снимки, на которых девушка блондинка, напоминающая Юлию, вела себя крайне откровенно и бесстыдно. Фолловеры заподозрили артистку в нечестной игре. В это время она лишилась многих подписчиков, но особо не расстроилась. Из рядовых участниц она переквалифицировалась в ведущие проекта.

Не всем понравилось такое перевоплощение. Кто-то откровенно критиковал Юлию за дикцию, подачу материала, отношение к другим участникам. Другая половина поклонников радовалась столь быстрому карьерному росту артистки. Юлия Ефременкова не оставляет за собой равнодушных людей. Она не упускает возможности поучаствовать и в других проектах. В 2018 году она стала участницей «стильной битвы», организованной брендом модной одежды O’STIN. Вместе с подругой по Дому 2 Майей Донцовой они делились секретами создания женских образов, правилами подбора одежды и аксессуаров.


Фото девушки до и после пластики

Пластическая операция намного улучшила ее и так эффектную внешность.
Можно сказать, что ее жизнь разделилась на до и после пластики. Сама Ефременкова не считает чем-то зазорным пользоваться услугами хирургов, если от этого зависит дальнейшая карьера. К тому же за счет установки виниров Юлия может похвастать красивейшей улыбкой. Юлия немного подкачала губы, увеличила бюст, изменила форму скул. Одним словом, довела свою природную красоту до собственных стандартов.


Сегодня Юлия остается ведущей шоу на ТНТ. Она делится новостями с подписчиками своих соцсетей, отдыхает на лучших курортах мира и пытается наладить свою личную жизнь

Личная жизнь

Первым мужем Юлии Кириенко стал Тимур Ефременков. Пара долго не регистрировала свои отношения. Наконец, они решились и Юлия сменила фамилию. Брак продлился недолго, но весело. Молодые люди были завсегдатаями модных тусовок. Они вместе завели собаку по кличке Милена. Муж Тимур снимался в кино и был достаточно востребованным актером. Он стал звездой таких фильмов, как «Легенда № 17», «Меч», «Проклятый рай». Вместе с женой он принял участие в реалити-шоу Тимура Родригеса «Дикие игры».

Что послужило причиной развода, пара не объяснила. В 2016 году супруги развелись. С бывшим мужем у Юлии прекрасные дружеские отношения. Раз в неделю он навещает йоркширского терьера Милену, которая осталась на попечении Юлии. Тимур воспринимает собаку в качестве ребенка, которого он должен в обязательном порядке навещать, как воскресный папа. Детей в семье не было.

Личная жизнь Юлии Ефременковой стала предметом обсуждения в сети. Девушка пыталась выстроить отношения с Глебом Клубничкой, Сергеем Захарьяшем и Сергеем Кучеровым. Первый оказался занят, второй уехал на Сейшелы с другой девушкой. С Кучеровым у нее сложился настоящий роман. Это была пара, которая лидировала в номинации «Любовь года». Кучеров сам ушел из проекта в 2018 году. Юлия немного погрустила и тут в ее жизни появился еще один мачо.


Юлия и Мондезир Свет-Амур

В 2019 году в шоу появляется новый участник – Мондезир Свет-Амур. Девушка быстро находит с молодым человеком общий язык. Отношения стремительно развиваются. В декабре парень подарил Юлии кольцо и выразил желание узаконить их отношения. Свадьбу назначили на лето.

stories-of-success.ru

Юлия Ефременкова — фото, биография, личная жизнь, новости, «Дом-2» 2020

Биография

На многих интернет-сайтах говорится, что Юля Ефременкова с детства поставила себе цель стать известной личностью и может похвастаться насыщенной биографией. Она стала участницей нескольких телепроектов, а затем начала карьеру телеведущей, которую с успехом продолжает по сей день.

Детство и юность

Юля Кириенко родилась в жарком южном Туапсе в апреле 1987-го. О родителях девочки в Сети информация разнообразная. Слухи и домыслы развеяла она сама, опубликовав пост в «Инстаграме». Благодаря ему стало известно, что мамой она называла бабушку. Биологические родители работали на Севере, а поскольку дочь болела, взять малышку с собой не могли. Заботы о воспитании легли на плечи бабушки.

Когда родители вернулись, девочке было уже 2 года. Чтобы не травмировать психику ребенка, оставили все как есть, и родную маму Юля называла по имени — Елена. Мать позднее умерла от воспаления легких, а отец еще раньше ушел из семьи. Бабушка, как пишет участница шоу в комментариях под фото в социальной сети, остается главным человеком в ее жизни.

Юлия Ефременкова с мамой

С 5 лет Юля увлеклась пением, через 3 года начала выступать на сцене, участвовала в различных городских мероприятиях. Уже в 12 лет юная певица записала первый диск. Переехав в Краснодар, поступила в музыкальное училище, которое с успехом окончила и начала работать по специальности.

По слухам, первым местом работы Юли стал местный ночной клуб. Там же девушка познакомилась с будущим мужем, с которым переехала в Москву. В столице Ефременкова с новой силой принялась совершенствовать вокал, пела в диско-группе «Диамант», в 2013-м по совету подруги пришла на кастинг в новую «ВИА Гру».

Наставницей девушки на шоу стала Альбина Джанабаева. Поначалу Юлия успешно продвигалась к финалу, у нее появились поклонники. Но под конец Ефременкова потеряла голос из-за болезни и готова была покинуть конкурс, если бы не поддержка мужа и бабушки. Качество пения подвело участницу, она выбыла из конкурса. Позднее Юлия отметила, что благодарна этому шоу хотя бы за то, что примерила роль звезды.

Личная жизнь

С актером Тимуром Ефременковым Юлия 4 года прожила в гражданском браке, прежде чем оформить отношения официально. Пара участвовала в семейном развлекательном шоу «Дикие игры», завела собаку — йоркширского терьера Милену и в такой компании много путешествовала.

В 2016-м супруги развелись, по словам Юлии, инициатива принадлежала ей. Что послужило основанием для расторжения брака, ни одна из сторон не сказала. Бывшие муж и жена сохранили дружеские отношения, созваниваются. Тимур шутит, что, как воскресный папа, раз в неделю навещает собаку, которую Юля забрала с собой.

Фолловеры Ефременковой полагают, что новая ведущая «Дома-2» по традиции не избежала стороннего вмешательства во внешность, в частности, акцентируют внимание на «подкачанных» бюсте и губах. По мнению специалистов, до пластики ее внешность была несколько иной. Также после предполагаемой пластики изменились нос и скулы Ефременковой. Сама Юля утверждает, что ее красота естественная, но в косметологических операциях нет ничего плохого, если делать их в меру.

Бывшая жена актера «Легенды №17» назвала истинные причины развода Юлия и Тимур Ефременковы // Фото: соцсети 30-летняя...

Опубликовано Real-lifes Пятница, 30 марта 2018 г.
Юлия Ефременкова (до пластики) и Тимур Ефременков

О том, что Юлия решилась на виниры, она сообщила подписчикам своего «Инстаграма». Изменения во внешности телеведущей, как ни странно, не порадовали ее поклонников. В адрес теледивы посыпались упреки в том, что она окончательно потеряла свою индивидуальность. На фото Юлии фолловеры стали отмечать асимметрию черт ее лица. Критике подверглась и речь Ефременковой: девушка начала проглатывать окончания слов, появились и другие дефекты произношения.

В 2019 году в личной жизни Юлии произошли кардинальные перемены. На проекте девушка познакомилась с участником шоу Мондезиром Свет-Амуром. Пара быстро нашла общий язык, а уже в декабре состоялось радостное событие — парень подарил своей избраннице помолвочное кольцо. Предполагалось, что свадьба состоится летом 2020 года.

«Дом-2»

Прийти на телестройку «Дом-2» Ефременкова решилась, когда в клубе, где она работала, увидела участника шоу Глеба Жемчугова. В декабре 2016-го состоялся приход Юлии, и объектом своего внимания девушка избрала как раз Глеба.

Поначалу на проекте девушка позиционировала себя как ревностного блюстителя нравственности, осуждала тех, кто не вписывался в принятые ею рамки морали. Так продолжалось до тех пор, пока в Сети не всплыли фото и видео скабрезного содержания, а изображенная там блондинка походила на Юлию.

Часть зрителей немедленно потребовала удалить обманщицу из шоу, однако Ефременкова не только не покинула площадку, но и из рядовой участницы превратилась в ведущую реалити.

Юлия Ефременкова и Мондезир Свет-Амур

С Глебом Клубничкой, как и со следующим претендентом Сергеем Захарьяшем, отношения не сложились. Первый уже обрел вторую половинку, а второй заявил, что отправляется на Сейшелы к другой участнице.

Следующим ухажером миниатюрной брюнетки (рост Юлии — 164 см, вес — 45 кг) стал Сергей Кучеров. Ефременкова разглядела в брутальном мачо мягкий характер, привлекло и то, что мужчина не попрекал Юлю ее прошлым. Пара одно время лидировала в конкурсе «Любовь года».

Еще в январе 2018-го, по словам Юлии, Сергей высказал пожелание уйти с проекта. Девушка поинтересовалась мнением поклонников, что же делать дальше. Одни посчитали, что молодым людям делать в реалити нечего, поскольку они уже обрели счастье. Другие высказались в том плане, что такие заявления всего лишь попытка Ефременковой заработать рейтинги.

Юлия Ефременкова в купальнике

В 2018-м одежный бренд O’STIN и женский интернет-журнал Woman.ru организовали «стильную битву» популярных влогеров, во время которой они делились секретами составления модного гардероба. Юлия Ефременкова участвовала в проекте вместе с Майей Донцовой, еще одной участницей «Дома-2».

Шоу, подобные «Стилю за 90 секунд», полезны для тех, кто старается не отставать от моды, но не успевает ходить по магазинам или модным показам, говорит Юля. Как большинство женщин, она любит красивые вещи и от участия в конкурсе получила незабываемое удовольствие. При этом заметила, что не боится проиграть, ведь у людей вкусы не совпадают, и услышать разные точки зрения об одной и той же вещи будет полезно.

Появление Юлии в «Доме-2» в новом статусе далеко не всем пришлось по душе. Одним не нравился голос новой ведущей, другим — отношение к остальным участникам и в целом поведение девушки. Нашлись и те, кто восторгался «служебным повышением» любимицы.

Юлия Ефременкова сейчас

Сейчас Ефременкова продолжает сотрудничество с «Домом-2», не всегда новости о телеведущей носят положительный характер. Осенью 2019 года, будучи на Сейшелах, девушка сильно заболела. Состояние здоровья Юлии настолько ухудшилось, что ее пришлось госпитализировать. Несколько дней знаменитость находилась под капельницами. К счастью, все обошлось.

24smi.org

биография, фото до и после пластики, что случилось на сейшелах, где сейчас, беременна

Красивая девушка, карьеристка, которая с самого детства привыкла добиваться всего сама — Юлия Ефременкова, ведущая из Дом-2. Тяжёлое детство закалило девушку и сформировало её характер. В 2020 она одна из самых красивых женщин России в ТОП-100 по версии журнала «Максим».

Смотреть все фотографии

Юлия Ефременкова
Настоящее имя:Юлия Ефременкова (в девичестве Кириенко)
Никнейм:Нет
Сфера деятельности:Телеведущая, модель
Дата рождения:2 апреля 1987 г.
Место рождения:Россия, Туапсе, Краснодарский край, живет в Москве
Знак Зодиака:Овен
Знак восточного гороскопа:Кролик
Национальность:Русская
Семейное положение:Разведена. Бывший муж Тимур Ефременков
Социальные сети

Фотографии с Юлией Ефременковой

Оценки пользователей

Оценки пользователей

Биография ведущей

Юлия с самого детства шла к карьере артистки. В 14 лет было принято решение переехать в Краснодар, и уже там она окончила среднюю школу и получила аттестат. Девушка с лёгкостью поступила в музыкальное училище. После окончания учёбы переехала в столицу.

Детство и юность

Родилась Юлия в Краснодарском крае в Туапсе. Воспитанием ребёнка занималась бабушка. Мама и папа работали на Севере и не могли взять её с собой. Когда родители вернулись с вахты, детская психика ребёнка так и не смогла принять сложившуюся ситуацию. И взрослые приняли решение оставить всё как есть. Биологических родителей Юля называла по имени, и даже когда они ушли из её жизни, она ничего не потеряла. Бабушка так и осталась самым близким и родным человеком для девушки.

С 5 лет Ефременкова занималась вокалом, с 8 выступала на сцене. В 12 был записан первый диск, который принёс известность девочке. Её стали приглашать на всевозможные городские мероприятия и праздники.

Путь к популярности

Профессиональная певческая карьера Юлии началась в 2008 г. в составе женской группы «Диамант».

В 2013 г. девушка дошла до финальной точки в шоу «Хочу в ВИА Гру». Опыт, приобретенный во время этой борьбы «за место под солнцем», Ефременкова считает очень ценным. Она увидела «изнанку» шоу-бизнеса и поняла главные правила выживания в нём.

Телевизионные эфиры песенного проекта были наполнены негативными эмоциями и практически «военными действиями» между девочками. В 2015 году Юлия была приглашена на семейное реалити-шоу «Дикие игры». Трансляция происходила на телеканале СТС. Вёл проект Тимур Родригез.

Первый успех

Познакомившись в клубе с Глебом Жемчуговым, девушка приняла решение стать участницей самого скандального шоу. В конце 2016 г. Юлия Ефременкова пришла на телепроект Дом-2. Изначально она выразила симпатию Глебу, но уже через 2 дня Жемчугов отказался от общения с девушкой, высказав в её адрес массу нелестных слов.

Красотка не растерялась и переключила свое внимание на самого спокойного участника проекта — Сергея Кучерова. Но даже с ним были скандалы, в интернете есть немало видео драк Юлии Ефременковой с парнем и девушками.

В конце 2017 г. продюсерский центр телеканала ТНТ предложил Юлии стать соведущей на воскресном шоу «Сплетницы». Перейдя в основной состав и став полноценной ведущей на телепроекте, Ефременкова получила славу и признание. Ни один пост, ни одно фото, выложенное в социальных сетях, не остается без внимания.

Настоящее и творческие планы на будущее

В 2018 г. Юлии было предложено сотрудничество с известным брендом OSTIN и женским журналом. Девушка должна была совместно со своей «заклятой» подругой Майей Донцовой вести битву вкусов и помогать девушкам в составлении своего индивидуального гардероба.

Личная жизнь

Своё прошлое Юлия не скрывает и информация находится в открытом доступе. С бывшим мужем Тимуром Ефременковым Юлия познакомилась ещё в Краснодаре. Позже к нему она переехала в Москву. Молодые люди 4 года жили в гражданском браке, и только в 2012 г. состоялось бракосочетание.

В 2016 г. было принято обоюдное решение развестись. По словам Юлии, брак просто «изжил» себя. Молодые люди разошлись мирно, по-дружески.

После развода Ефременкова решила «строить любовь» на телепроекте Дом-2. Долго девушка металась между поклонниками, симпатиями.

  1. В 2016 г. Юлия попыталась строить отношения с Сергеем Захарьяшем, но парень отказал девушке.
  2. Потом был Сергей Кучеров. Парень даже сделал Ефременковой предложение руки и сердца, и она согласилась. Отношения молодых людей были похожи на качели. То взлёты, то падения. Сергей уходил с проекта, Юлия оставалась. Потом Кучеров вернулся и страсть вспыхнула вновь. В начале 2019 г. пара всё-таки распалась из-за абсолютно разных взглядов на жизнь и интересов.
  3. Весной 2019 вспыхнул новый не менее скандальный роман. Ефременкова приняла ухаживания горячего парня — Мондезира Свет-Амура. В отношениях молодых людей было всё: ссоры, страсть, конфликты, примирение.

Юлия Ефременкова и Мондезир Свет-Амур

Вокруг свежеиспечённой пары ходит масса слухов. Поклонники заметили, что у Ефременковой округлился живот, сразу разлетелась по социальным сетям информация о беременности девушки.

Внешность

Раньше ходили слухи, что Ефременкова эскортница, но если посмотреть на фото прошлых лет, то вряд ли услуги её сопровождения стоили дорого, выглядела девушка плохо.

Судя по фотографиям, находящимся в открытом доступе, рука пластического хирурга участвовала в создании образа Юлии Ефременковой. Девушка категорически отрицает этот факт, но сравнительный анализ фотографий до проекта и сейчас — явное подтверждение вмешательства. Раньше её фотографии без макияжа приводили людей в откровенный ужас, но сейчас ситуация совсем иная. Лицо стало намного ухоженнее и свежее, изменилось очень многое в очертаниях, они стали более женственными.

Рост164 см
Вес61 кг
Цвет глазЗеленый
Цвет волосБрюнетка от природы. Часто экспериментирует с новыми цветами и тонами
ТатуировкиСудя по фотографиям в стиле «ню», татуировок на теле девушки нет
Пластические операцииСо слов самой девушки их не было. Но не видит ничего плохого в пластике. Главное, чтобы все мероприятия проводились в меру. Если сравнить фото до и после пластики, то видны: ринопластика, увеличение губ филлерами, блефаропластика и липосакция подбородка. Также девушка сделала себе виниры на зубах.
Внешность Юлии Ефременковой

Социальные сети

На странички в социальных сетях девушка в основном выкладывает материал для собственного пиара. Масса постановочных фото красивой девушки иногда разбавляется совместными фотографиями с Мондезиром. На Инстаграм подписано почти 1 млн человек. Юлия с огромным удовольствием берется за любые рекламные проекты, и для этого на страничке есть специальная контактная информация.

Интересные факты

Личная жизнь девушки очень часто раскрывалась новыми и новыми подробностями. Весной 2017 г. на Доме 2 разгорелся скандал с участием Юлии. В сети всплыли кадры из порнофильмов, в которых участвовала Ефременкова. С достоинством певица ответила всем в своем Instagram:

«Самое главное что близкие живы и здоровы, а остальное неважно! Грехи других судить Вы так усердно рветесь, начните со своих и до чужих не доберетесь».

После того как девушка всерьёз увлеклась новым романом, слухов ходит немало. Самый известный из них — почему Свет-Амур не делает предложение или сделал, а Юлия отказала. Но тут парочка предпочитает отговорки о проверке крепости чувств.

Окончательно понять, что Мондезир — её мужчина, помог очень неприятный случай. После того, что случилось с Юлией Ефременковой на Сейшелах она всерьёз готовится стать примерной женой и матерью. Девушка была госпитализирована после того, как почувствовала сильные боли в области живота. В течение пяти дней у неё держалась высокая температура. В больнице был поставлен диагноз, и, по словам девушки, ей предстоит долгое и сложное лечение. Чем заболела на Сейшелах, она так и не рассказала никому.

Юлия поблагодарила всех, кто поддерживал ее в этот сложный момент. Особенно теплых слов она удостоила Мондезира:

«Спасибо моему любимому, который поставил на уши всех и лишний раз дал возможность убедиться, что он у меня и для меня самый лучший».

Пока Юлия не выступила с официальным видео на страничке в Инстаграме и не объяснила поклонникам, что с ней произошло и где сейчас она находится, многие переживали, куда пропала любимая ведущая и были уверены, что она беременна.

Вам понравилась статья про Юлию Ефременкову? Пожалуйста, оцените нашу работу

Не понравилось

Понравилось

Мало информации

kumir.online

Дом 2 Юлия Ефременкова – биография, википедия, фото, инстаграм

Юлия Ефременкова – биография

 Родилась кроха весной 2 апреля 1987 года в курортном городке под названием Туапсе. Видимо, черноморский воздух навеял девочке мечты о дальних странствиях, о популярности и желании стать звездой.

Девичья фамилия Юлии – Кириенко, а фамилия Ефременкова досталась ей от первого мужа, о котором мы поговорим немного позже.

С пяти лет девочка уже выступала на сцене, была очень яркой и запоминающейся. В восемь – занялась вокалом и училась петь профессионально, а в двенадцать ее мечты начали сбываться. Юлия отправилась с концертом на Кипр, здесь же, на острове, она записывает первый диск.

В четырнадцать юная звездочка вместе с семьей переезжает жить в Краснодар. Именно здесь она поступает в музыкальное училище, успешно его заканчивает и начинает работать по специальности.

Она заключается в работе в одной из ночных клубов курортного городка, где ее яркую внешность не мог не заметить успешный молодой человек, будущий муж красавицы Тимур Ефременков.

Юлия Ефременкова и ее муж Тимур

Начинались отношения Юлии Ефременковой и её мужа Тимура как в красивой сказке. Тимур оказался начинающим артистом из Москвы, куда и увозит милую и нежную возлюбленную.

Молодые, соединенные узами Гименея, обосновались в столице. Юле хотелось всего, сразу и много. Она начала активно посещать различные кастинги, желая стать участницей музыкальной группы или сделать сольную карьеру. Муж всячески старался помочь супруге, поддерживал ее во всех желаниях обрести популярность. Сам же Тимур прославился тем, что был замечен в сериале «Глухарь» и в нашумевшем фильме о хоккеисте «Легенда 17».

Старания Юлии не прошли даром. Она стала участницей группы под названием «Диамант». Симпатичные барышни исполняли песни в стиле диско.

В 2013 году Ефременкова попала на кастинг телевизионного шоу «Хочу в ВИАгру». Кстати, голосистая певица сумела дойти до финала. Эта информация содержится на странички жгучей брюнетки в Инстаграме.

Далее, семейная пара – Юля и Тимур приняли участие в экстрим-съемках «Дикие игры». При взгляде на пару даже не было мысли о том, что у них начинается раскол в отношениях. Стоит отметить, что это был последний совместный проект ребят, как супружеской четы.

В 2016 году пара развелась официально.

Компромат на Юлию Ефременкову

На протяжении длительного времени длинноволосая брюнетка позиционировала себя как целомудренное создание, бережно хранящее свою незапятнанную репутацию. Более того, скромница активно порицала и осуждала всех, кто по ее параметрам не был образцом нравственности. Особенно критике подвергались участницы, являющиеся одинокими мамочками или те, у кого не было каких-либо моральных принципов.

Но все это был до того времени, пока в интернете не появился компромат на Юлию Ефременкову! Видео, где участница полностью обнажена и завлекает своим видом противоположный пол, быстро стало популярным. Различные участники сообщества стали сразу писать гневные отзывы и говорить о том, что развратницу нужно немедля изгнать из программы. Ведь не так давно, за нечто подобное был отправлен восвояси Владимир Жиган.

Кстати, видео есть возможность найти у нас на сайте, также здесь есть ряд пикантных фото. Прелести Юлии выставлены на всеобщее обозрение, сразу видно, что делает это она с большой радостью без особого принуждения. Девушка пластина, раскрепощена и у нее нет никаких комплексов. Только раньше она была сексуальной блондинкой, видимо, это больше привлекало внимание клиентов, приобретающих видео эротического содержания.

Бывший муж Юлии Ефременковой – Тимур

До сих пор общественность интересуется, почему Юлия рассталась с сорокалетним Тимуром, делая всяческие предположения по этому поводу.

В основном фанаты предполагают, что пара рассталась именно по причине появившегося компромата на девушку. Супруг не смог ей простить обман, не желая быть посмешищем. Он все-таки популярный актер и не пристало столь публичной личности появляться в богемном мире с дамой, мягко говоря, с сомнительным прошлым.

Сама же девушка настаивает на том, что развестись с мужем – это ее инициатива. Артист согласился, чтобы супруга оставила себе его фамилию, что она и сделала.

Сегодня Тимур успешно снимается в фильмах, сериалах и говорит о том, что с экс-женой у него прекрасные, дружеские отношения. Они цивилизованные люди и не собираются выносить сор из избы и трясти публично грязным бельем.

Заметим, что молодые люди прожили в браке четыре года, детей у них не было. Зато была небольшая собачка, породы йорк по кличке Милена.

Юлия забрала песика с собой и искренне любит пушистенького питомца, на что тот отвечает взаимностью. Она старается проведывать собаку не реже одного раза в неделю.

Участие на проекте Дом 2 Юлии Ефременковой

Придя на передачу, темноволосая красавица сразу изъявила желание строить любовь с женатым Глебом Жемчуговым. Прошло не так много времени, и Юлия уже осыпала Клубничку, такая в сове время была кличка у участника проекта, когда он был холостяком, страстными поцелуями. Но этим дело не ограничилось, девушка соблазнила Глеба и провела с ним ночь в спальне для девушек. После Жемчугов отправился в комнату к жене, под ее крылышко. Также Глебушка отметил, что Ефременкова злобная, хабалистая тетка. В общем, отношения не сложились.

Далее, на Юлю обращает свое внимание Сергей Захарьяш, но у ребят также ничего не получилось. Молодой человек изъявляет желание оправиться на остров, чтобы быть с Лизой Полыгаловой, Юля же прекращает с парнем общение.

Следующим стал Сергей Кучеров. Участник стал ухаживать за длинноволосой брюнеткой, а девушку в нем привлек покладистый характер, а еще лояльное отношение парня к ее прошлому.

Сейчас пара проводит свое время на острове любви. Ребята иногда ссорятся, поводом размолвок становится пара Захарьяша и Юлии. Сергей часто раздражает Ефременкову, да и она не остается в долгу, постоянно пытаясь задеть парня, поддеть, вызвать на эмоции.

На остров прилетает бывшая пассия Кучерова – Ангелина Татишвили и он вступает с ней в сексуальную связь, как только она прилетает. Но вот с ночевкой вновь отправляется к официальной подруге.

В общем, настоящий любовный треугольник. Чем же закончится дело? Неизвестно.

Поклонникам Юли Ефременковой можно узнать о ней больше, следя за новостями из ее страничек на сайте Одноклассники, ВКонтакте и Инстаграм. Также немало информации о девушке есть и на официальном сайте популярной телестройки, где создают и ищут настоящую любовь.

А что вы думаете о Юлии Ефременковой? Ответы оставляйте в комментариях

y-wikipedia.ru

Экс-супруга Тимура Ефременкова раскрыла истинную причину развода с актером

10:58, 31.03.2018

Юлия Ефременкова призналась, что рассталась с мужем не из-за измен.

Поделиться | Понравилось

30-летняя Юлия Ефременкова развелась с актером Тимуром Ефременковым два года назад. Звезды приняли решение разойтись после восьми лет отношений, четыре года из которых провели в официальном браке. На этой неделе Юлия дала интервью одному из российских изданий, в котором честно рассказала, почему ушла от мужа.

Тимур Ефременков и Юлия Ефременкова

По словам Ефременковой, причиной расставания стал не измены. «Изменял – да, но не в этом причина развода. Как-то поссорились сильно, даже расстались, и он сходил налево. Я это чувствовала, поэтому когда снова сошлись, постоянно пытала: было – не было. Говорила, что не обижусь и все пойму. А как-то перед Новым годом мы лежали в кровати, как вдруг раздался звонок… Услышала женский голос, а муж начал невнятно оправдываться», – вспоминает экс-супруга Тимура.

Юлия также рассказала, что заставила Ефременкова перезвонить девушке и по громкой связи озвучить текст, который придумала. Тут же стало понятно, что звонила одна из любовниц актера. После этого пара серьезно поссорилась, но вскоре снова помирилась. Правда идиллия продлилась недолго – бывшая жена Тимура призналась, что постоянно испытывала страх неопределенности, находясь в отношениях с актером. «Было сложно простить, но важнее, чтобы человек оставался морально верен. Физическую измену с трудом, но могу оправдать, а вот моральную – никогда. Его я простила и мы поехали к маме встречать Новый год. Поэтому причина расставания иная – Тимур проиграл нашу любовь. Мог спустить состояние на развлечения. Может, поэтому у нас и не было детей, боялась рожать. Страшно жить с мыслью, что все можно потерять в любую секунду, хотя бывший муж очень хороший человек и продолжает меня любить», – сообщила Ефременкова в интервью журналу «Дом-2».

Сергей Кучеров и Юлия Ефременкова

Напомним, что после расставания с Тимуром Ефременковым, Юлия Ефременкова (в девичестве Кириенко) решила искать свою любовь на проекте «Дом-2». Телезвезда пыталась построить отношения с Глебом Жемчуговым и Сергеем Захарьяшем, но у них что-то не сложилось. После этого Юлия обратила внимание на Сергея Кучерова, и их общение из дружбы переросло в настоящую любовь. 16 марта звезды вместе ушли с проекта.

Читайте также:

Знаменитости, которые начинали карьеру в «Доме 2», но об этом все забыли

Почему девушки из «Дома-2» становятся успешнее парней, с которыми встречались на проекте

www.vokrug.tv

Юля Ефременкова поломала жизнь Сергею Кучерову

Сегодня в эфире должны показать уход Сергея Кучерова. Или не уход, а желание это сделать… В любом случае, выяснения отношений между бывшими нам, судя по всему, не избежать.

Не знаю, как преподнесут историю в эфире, но уже сейчас могу сказать: жалко Серегу. Я никогда не относилась к числу его ярых фанатов и бывала довольно жесткой в высказываниях, когда он этого заслуживал, но сейчас, как мне кажется, правда на его стороне. А Юля попросту мстит.

По сути, придя на проект, Сережа ничего плохого не сделал. «Вернулся в дурку» на убедительное обвинение не тянет. Юля тоже, пардон, «в дурке». Да, она ведущая. Но зарабатывает точно так же, как и остальные «хомяки»: копается в грязном белье подопечных и позволяет им копаться в своем. А еще Юля с готовностью закрывает бреши в эфирах, и в сотый раз перемалывает свою любовную историю, рыдая и заламывая руки. Играет красиво, слезно, но переигрывает. Лично я уже не верю ни в ее любовь, ни в ту боль, о которой она кричит. Слишком много! Слишком громко! Слишком часто!


По-моему,  все просто. Юля увидела, как Сережа снимает попки девочек и заселяется с одной из них, и жутко заревновала. Но не от любви, а потому что «мое»! Она-то верила, что «рядовой хомяк» Кучеров будет смотреть на нее, всю такую звездную и недосягаемую, и тихо умирать от страсти, осознавая, кого он потерял.  А оказалось, что он, подлец, смеет жить беззаботно и даже веселиться. Вот ревнивица и решила подпортить жизнь бывшему и заодно лишить его халявы. Для чего и положение свое служебное использовала: начальство не смогло бы долго смотреть, как  сотрудник мучается и не может сосредоточиться на работе.

А Серега молодец! Сам все понял и сам принял решение. Да, ушел в никуда, да, выложил печальный пост, дескать, мне 28, права отобрали, тачки нет, любви тоже. Но зато не унизился. Уж простите меня, антики, но я не считаю, что парень ушел с позором. Наоборот, он отказался учас

dom2tv.ru

«Он едва не зарезал меня!»

Ведущая «ДОМа-2» рассказала, как прошла через болезненные отношения. Юлия Ефременкова долгое время состояла в связи с бандитом, который чуть было не лишил ее жизни. Как все происходило, звезда телестройки рассказала журналу «ДОМ-2».

Юлия Ефременкова
​Фото: Олег Зотов

Плотный рабочий график, про­блемы в отношениях с Сер­геем Кучеровым и болезнь мамы — новая ведущая проекта давно забыла, что такое отдых. Но трудно­сти не пугают 31‑летнюю телезвезду — с раннего детства Юля знала, что обя­зана быть сильной и лучшей.

МАМИНА ДОЧКА

Когда мне было пять лет, я не пред­ставляла жизнь без пения. Тогда мама решила отдать меня на вокал и при­вела за руку к местному преподава­телю. «У нее нет слуха» — таков был вердикт. Но отступать мы не хотели, поэтому целый год занимались дома, после чего решили попытаться вновь. Меня вместе с более одаренными детьми взяли прослушать основной курс. Помню, как на середине урока меня жутко клонило в сон, потому что я была тогда маленькой и сла­бой. Но сидеть на скамейке запас­ных не могла — по природе я лидер. Так что в семь лет «не поющую» меня и еще четверых детей отправили на вокальный конкурс. Тогда я впер­вые победила. Так жизнь преврати­лась в гастроли.

Мама легко отпускала тебя одну?

Да. Ей и самой приходилась много работать, чтобы содержать семью. Она понимала, что мне ничего не достается на блюдечке. Когда у меня появилось желание разви­ваться в народном вокале, мамочка поддержала. Правда, это удовольствие оказалось не из дешевых, благо, поя­вился спонсор. До сих пор благодарна Александру Савельевичу Яровенко, с которым познакомилась в Туапсе. Он выделял огромный бюджет на мое образование и каждый мой конкурс, а когда мне исполнилось 12, он отпра­вил меня учиться в Краснодар в хоре­ографическое училище и даже снял просторную квартиру. Признаюсь честно, было сложно. Там дети зани­мались балетом с трех лет, поэтому приходилось пахать до потери созна­ния. Это еще больше закалило мой характер, что в будущем помогло мне пройти кастинг на «Фабрику звезд».

Какую песню ты тогда пела?

Коронную тех лет — «Метелица» Валерии. Комиссия прослушала, но ни «да», ни «нет» не сказала. И я решила вернуться к маме.

Позже узнала, что попала на «Фабрику», но надо было заплатить 1000 долла­ров на содержание в звездном доме. Уговаривали долго, рассказывали, как буду петь с известными арти­стами на одной сцене. Денег не было, но мамочка готова была обойти всех родственников, чтобы собрать нуж­ную сумму.

Я махнула рукой — у меня уже был опыт выступлений со звез­дами, и ничего в этом классного я не видела, а тут еще и деньги платить… Отказалась! Но потом, когда по теле­визору увидела, что это за шоу, конечно, сильно кусала локти.

Ефременкова пожалела, что не пошла на «Фабрику звезд»
​Фото: Социальные сети

Знаю, мама тогда лежала в больнице. Так ты не по этой причине отказалась?

Да, лежала, но она бы отпустила. Был момент, когда мама была на грани жизни и смерти. Случился серьезный приступ, пришлось срочно удалять метр кишечника, а у нее до этого уже было больше 20 операций. Как сей­час помню слова врача:

«Я не пугаю, но скажу одно: если маму не опери­ровать — она умрет, если опериро­вать — может умереть».

В ту ночь я чуть с ума не сошла. Опера­ция длилась очень долго — около двух часов. Когда родную вывезли, она была вся синяя, с реанимационной маской. Показа­лось, что я видела смерть… Начала так орать, что раз­будила абсолютного каждого в больнице.

Что так подкосило ее здоровье?

Мамуля была воздушной гимнасткой. Она многое пережила. Мама потеряла сыновей: первый в роддоме умер, с другим успела выписаться, но про­жил ребенок недолго. В молодости же у нее обнару­жили серьезное заболевание, положили на 7 месяцев в питер­скую больницу. Ее мама устро­илась рабо­тать уборщи­цей, чтобы быть рядом с дочкой. А дедушка был моря­ком — привозил из рейсов для нее такие подарки, каких в стране никто не видел.

УХОДИ ПО-АНГЛИЙСКИ

Оглядываясь назад, Юля не верит, что за свою жизнь столько всего пережила
Фото: Олег Зотов

Ты не пошла на «Фабрику», верну­лась домой… Что было дальше?

После кастинга на «Фабрику звезд» попала в группу «ОРЗ», продюсер тогда как раз искал третью солистку. Не могу сказать, что была довольна работой: привыкла пахать, а там все было просто и легко. Так надоело, что купила билеты в Краснодар, и когда мне позвонили с вопросом, почему я не на репетиции, оша­рашила их своим ответом: «Рабо­тайте без меня». Вернувшись домой, собрала свою группу. С подружками шили костюмы, репетировали дома на каблуках так, что побили весь пар­кет. Хорошо, мамочка тоже твор­ческая личность, поэтому ничего не запрещала. Песни были модные, клубные, а не простая попса. Зараба­тывать стали не сразу: сначала высту­пали бесплатно у друзей, а когда рас­крутились, предложения полились рекой.

Так, выступление на Дне города Туапсе кардинально изменило мою жизнь — именно там в 17 лет я позна­комилась со своим «бандитом», кото­рый стал моим первым мужчиной.

Ефременкова считает встречу с бандитом судьбоносной
Фото: Олег Зотов

Ты говорила, что это была судьба.

Да. Тогда меня еле уговорили высту­пать. Репетицию назначили на утро в местном доме культуры. До этого был концерт, где мы попали под жут­кий ливень, и я сильно простудилась, поэтому перенесли прогон на обед. В дверях ДК я столкнулась с мужчи­ной. Позже выяснилось, что его знал весь город. А я позволила себе ему нагрубить. Наверное, это его и разза­дорило. Потом пересеклись на репети­ции, после чего на меня тут же навели справки. Так что, если бы не стече­ние обстоятельств, наша встреча вообще бы не состоялась.

Я так понимаю, имя его не назовешь?

Нет, ты что! Я еще дорожу своей жиз­нью! В тот день он попросил своих людей залезть в мою сумку, забрать телефон и набрать его личный номер. Но друзья осадили: «С Кириенко (девичья фамилия Юлии — прим. ред.) лучше не связываться». Конечно, он и без этого узнал мои контакты. Кстати, он был несвободным муж­чиной. Город маленький, поэтому до его женщины быстро дошли слухи. Она выясняла со мной отношения на глазах всего Туапсе. Трясущаяся подбегала на концерте и, называя меня последними словами, кричала: «Кто тут Юля? Зачем ты рушишь отно­шения?» Честно, мужчина и несильно был мне нужен, но в силу характера я подумала: «Ах ты, ну все, теперь точно будет мой».

Когда до родствен­ников дошла информация, у мамы случился приступ. Она сильно испу­галась, поскольку знала, что его папа вор в законе. Помню, меня даже на улицах останавливали со словами, что наши дети возьмут на себя грехи отца.

Самое интересное, что до пере­езда в Краснодар, пока я жила в Туапсе, мы с ним были соседями. На районе бандиты часто бегали с пистолетами. Так что мы несколько раз пересекались, но мужчина был на 12 лет старше и поэтому не привлекал моего внимания. С мамой постоянно вспоми­наем ситуацию, когда возвра­щаясь домой, стали свиде­телями его криков на свою девушку посреди улицы. «Никогда у меня такого мужа не будет», — заявила тогда я.

Звезда телестройки с юности понимала, какого мужчину хочет видеть рядом с собой
Фото: Олег Зотов

Когда ты столкнулась с ним в дверях, неужели не узнала?

Если бы узнала, даже разговор бы не завела.

Столько пережила в этих отношениях: угрозы, перестрелки и даже выезды на кладбище. Наверное, поэтому у меня такая подорванная психика.

Он поднимал на тебя руку?

Однажды схватил за шею и, под­няв над полом, начал трясти, глаза его тогда налились кровью. Думала, что убьет, но сама была виновата. В конце наших отношений у меня серьезно поехала крыша, можно сказать, была на пороге лечебницы для не совсем здоровых людей. Просто то, что я знала о нем — несовместимо с жизнью. В любой момент могли убить.

Почему же ты не ушла?

Он меня безумно любил, даже до сих пор не женился. Когда созванивались года полтора назад, сказал, что его женой могу быть только я, и дети у него могли быть только от меня. Но его любовь была маниакальной — ревновал даже к маме. В один момент я просто сбежала из дома без всего.

Испугалась за жизнь?

Он чуть не зарезал меня. Никогда не бил, но психологически действо­вал так, что лучше бы ходила в синя­ках. В ту ночь так сильно приревновал, что я боялась уснуть и не проснуться.

Обещала выпрыгнуть в окно, если двери не откроет. Об этом сообщила маме, и она каким‑то чудом уговорила его выпустить меня.

Куда ты сбежала?

В Краснодар. Но преследования про­должались. Стоило, например, подойти к подъезду, как раздавался звонок, и знакомый голос подробно описывал, в чем я одета, в какую сторону повер­нула голову. Спасло чудо — его объя­вили в федеральный розыск.

ЛЮБОВЬ И ДРУГИЕ ЛЕКАРСТВА

До проекта Ефременкова пыталась построить карьеру в шоу-бизнесе
​Фото: «Инстаграм»

Как потом складывалась твоя личная жизнь?

После моего бандита появился состо­ятельный мужчина Дима. У нас была разница в 26 лет. Кстати, мы остались в хороших отношениях.

Это была любовь?

Нам было приятно проводить вместе время. Во-первых, я не знала, что он старше. Во-вторых, он был краси­вым и благородным. Единственным недостатком было то, что до нашей встречи от него забеременела девушка.

Глупенькая, пришла делать замеры для ремонта кухни. Мерки сняли и переспать успели. Конечно, Дима сомневался, что ребенок его. Поэ­тому вместе ездили делать тест ДНК. Спустя несколько месяцев у него родился сынок.

Потом познакомилась с Тимуром — бывшим мужем. Встре­тились в ночном клубе, он приехал в Краснодар сниматься в фильме вме­сте с Еленой Кориковой. До встречи со мной Тима не верил в любовь с пер­вого взгляда… Но вот место в моем сердце он занял не сразу. Как‑то Тимур по совету друзей сделал последнюю попытку и попал в хорошее настрое­ние — я решила ответить на его сооб­щение. Для меня важно получать смс: Ты поела? Тепло одета? В один момент, когда Тимур не пожелал доброго утра и не спросил, позавтракала ли я, стало очевидно, что не могу без него. При­ехала в гости на три дня, а на второй день он предложил расписаться.

На какие деньги жила до замужества?

Мама помогала, что‑то сама зараба­тывала. Повезло, что рядом всегда было мужское плечо. Но сильно любила только двоих мужчин: Тимура и Сережу.

Почему ты рассталась с мужем? Изменял?

Изменял — да, но не в этом причина развода. Как‑то поссорились сильно, даже расстались, и он сходил налево. Я это чувствовала, поэтому когда снова сошлись, постоянно пытала: было — не было. Говорила, что не обижусь и все пойму. А как‑то перед Новым годом мы лежали в кровати, как вдруг раздался звонок… Услышала женский голос, а муж стал невнятно оправдываться. Попросила набрать поклонницу, включить громкую связь и повторять текст, который сама же и написала. Девушка сразу освежила его память. Тогда в Тимура летело все подряд. Было сложно простить, но важнее, чтобы человек морально оставался верен. Физическую измену с трудом, но могу оправдать, а вот моральную — никогда. Его я простила, и мы поехали к маме встречать Новый год.

Поэтому причина расставания иная — Тимур проиграл нашу любовь. Мог спустить состояние на развлечения. Может, поэтому у нас и не было детей, боя­лась рожать.

Страшно жить с мыс­лью, что все можно потерять в любую секунду, хотя бывший муж очень хоро­ший человек и продолжает любить меня.

Бывший муж Юли Ефременковой, по ее словам, все еще любит ее
Фото: Социальные сети

После расставания с ним ты пришла на проект?

Да, ушла на проект, встретила и построила любовь. Плюс смогла добиться карьерного роста. Стать веду­щей — огромная честь. До сих пор не осознаю, хотя чувствую невероят­ную ответственность. Хожу на курсы по технике речи к Марии Дараган. Серьезно занялась вопросом состо­яния кожи лица. В клинике Ольги Мороз мне подарили невероятное преображение.

Помнишь день, когда тебе сообщили об этом?

Да. Как‑то резко вызвали в кабинет к руководству. «Давно за тобой наблю­даем…» — услышала я и решила, что хотят красиво слить. Когда сказали о должности ведущей, то не поверила своим ушам, даже никак не отреагиро­вала, за что потом миллион раз изви­нялась. Выйдя из кабинета, позвала Алексея Николаевича Михайлов­ского. Он всегда был для меня кем‑то больше — другом, люблю его как настав­ника. Конечно, когда он поки­дал наш «дом», казалось, меня бросили на произвол судьбы. Напоследок попросила разре­шения обращаться к нему за советами.

Что сейчас самое главное для тебя?

Перевезти мамулю, хочу ухаживать за ней. Сахарный диабет — страшная болезнь. Благо есть любимый муж­чина, который поддерживает. Да, ссо­римся, но каждый раз понимаю, что Сережа тот самый мужчина. Уве­рена в нем на 100 процентов и, если забеременею, то выберу семью.

dom2life.ru

«Я хочу проверить отношения с Сережей за периметром»

Девушка призналась, что пока не готова создать семью со своим возлюбленным. Юлия Ефременкова озвучила Dom2Life причины конфликтов с Сергеем Кучеровым. Брюнетка также пояснила, чего ей не хватает для гармоничных отношений.

Фото: «Инстаграм» Юлии Ефременковой

Юлия Ефременкова продолжает ругаться со своим бойфрендом Сергеем Кучеровым. Ребята плачут на лобных местах, часто бросаются «громкими» словами и сомневаются друг в друге. Однако расставаться пара не собирается. Юля призналась, что их отношения с Сережей никогда не будут простыми. Девушка ссылается на то, что они с возлюбленным похожи — оба лидеры, считающие свою позицию единственно правильной. Но брюнетка все-таки признала свои ошибки и сказала, что нужно сделать для гармонии в семье.

«У нас отношения «лайтовыми» не будут никогда. Для меня важно доверять, ведь если я не доверяю, мне сложно выстраивать отношения. Сережа всячески пытается сделать так, чтобы я ему верила. Мне нужно только в своей голове покопаться, разобраться в своих тараканах, потому что другие люди не при чем…

Я в принципе людям сложно доверяю, тяжело к себе подпускаю. А если они когда-то совершили проступок по отношению ко мне, то я их разглядываю под микроскопом. Нужно отпустить все эти ситуации, ведь если этого не сделать, то мне будет очень тяжело, а моему мужчине и подавно сложно», — разоткровенничалась девушка в эксклюзивном интервью Dom2Life.

Юлия призналась, что любит Сергея и говтова меняться ради него
Фото: «Инстаграм»

Также Ефременкова призналась, что тема семьи и детей для нее очень серьезная. Юлия была в ступоре, когда узнала на лобном месте о желании Сергея иметь от нее малыша: «Да, мы проговаривали этот момент, но это было не конкретно, а вскользь». Она заявила, что рожать ребенка нужно только в гармоничных и проверенных отношениях. А убедиться в верности второй половинки можно исключительно вне проекта.

«У нас есть собака, и я вижу, как Сережа к ней относится, как он себя с ней ведет. Я знаю точно, он будет прекрасным отцом. Но я не готова сейчас к детям. Мне хочется отношения проверить за периметром, потому что здесь мы в тепличных условиях. Что будет там, за воротами, никто не знает», — рассказала девушка Dom2Life.

Брюнетка добавила, что для нее важно, чтобы рядом был мужчина, который станет главным в отношениях. Она призналась, что всегда пыталась «прогнуть под себя мужиков». Сейчас Ефременкова осознала, что не она, а именно Кучеров должен занять лидирующую позицию в их паре. «Он меня подминает под себя, и меня это устраивает. Я в нем эти качества очень ценю. Вот такого мужчину рядом с собой по жизни и хочу видеть», — подытожила Юлия.

Сергей Кучеров и Юлия Ефременкова
Фото: «Инстаграм»

dom2life.ru

биография и участие в шоу, брак и отношения, разоблачения и вся правда о звезде «Дома-2»

Очаровательная видная брюнетка многим запомнилась своим участием в телестройке «Дом-2». Биография Юлии Ефременковой достаточно насыщенная и богатая событиями. С ранних лет она знала, что будет знаменитой, прикладывала к этому максимум усилий и в итоге добилась своего. На Инстаграм красотки подписано более 800 тысяч человек. А тот факт, что некоторое время назад появилось порновидео с участием Юли, не уменьшило число ее поклонников.

Детские годы

Юлия Кириенко (именно такова девичья фамилии брюнетки) родилась в 1987 году 2 апреля, в городе Туапсе. Родители будущей знаменитости работали на севере, поэтому воспитанием Юли занималась бабушка, которую та ласково именовала «мамой». Девочка при рождении была болезненной, поэтому перебраться с родителями в суровые условия тайги не могла. Семейная жизнь родителей не была гладкой: отец рано покинул свою супругу, а сама Юля так и продолжила называть родную бабушку матерью, а мать — по имени.

Петь малышка начала очень рано, с трех лет. Она принимала участие в разнообразных конкурсах городского уровня, везде запоминалась своей лучезарной улыбкой и волей к славе и вниманию. В 12 лет ей удалось записать свой первый диск, что подарило Юле веру в то, что у нее все получится.

Перебравшись в Краснодар, будущая знаменитость становится учащейся музыкального колледжа, заканчивает его одной из лучших на курсе, после чего решает работать по специальности.

Первые успехи

Очаровательная молодая девушка, обладательница правильных черт лица и точеной фигуры, устраивается на работу в ночной клуб Краснодара и, конечно, быстро обзаводится толпой поклонников. Один из них, Тимур Ефременков, становится ее мужем. Это начинающий актер, так же, как и сама Юля, жаждущий славы. Он увозит супругу в столицу, где и начинается путь Юлии к вершине славы.

Девушка оказалась слишком амбициозной. Сидеть дома и исполнять обязанности домохозяйки было ей не по душе, поэтому она с удивительной настойчивостью стала посещать различные кастинги, желая стать участницей одной из популярных групп. Тимур оказывал своей возлюбленной поддержку, поскольку понимал, насколько важно для нее воплотить в жизнь свою мечту.

Первый успех не заставил себя долго ждать: красавицу заметили, и она стала участницей поп-коллектива «Диамант», исполнявших песни в стиле диско. Однако особой популярностью группа, несмотря на яркую внешность исполнительниц, не пользовалась.

Ефременкова не сдавалась, и в 2013 году приняла участие в проекте «Хочу и Виагру», в котором проводился кастинг в самую соблазнительную группу современной поп-сцены. Несмотря на то что желающих стать солисткой команды было более чем достаточно, Юлия сумела пробиться в финал. Но удача от нее отвернулась. В итоге в тройку победительниц вошли:

  • Маша Романова;
  • Настя Кожевникова;
  • Эрика Герцег.

Стать участницей «Виагры» Ефременковой не удалось, но она и не думала сдаваться. Шоу помогло ей прославиться, обзавестись армией поклонников, а также узнать все подводные камни шоу-бизнеса. В одном из интервью девушка делилась, что прошла через ад: репетиции проходили по ночам, а сами номера были технически сложными.

Вместе с Тимуром Юлия приняла участие в программе «Дикие игры», съемки которой позволили ей познать все грани экстрима. Однако в 2016 году они расстались, вызвав удивление у поклонников селебрети. Никому даже в голову не приходило, что эти влюбленные и нежные супруги могут охладеть друг к другу.

Эпоха телестройки

Следующим шагом в карьере красавицы стало участие в скандальном реалити-шоу «Дом 2», куда она пришла в декабре 2016 года. Причина такого поступка проста: в клуб, где работала Юля, зашел один из популярных участников проекта, Глеб Жемчугов. Он настолько понравился девушке, что она решила попробовать построить с ним отношения на виду у всей страны. Не остановило роковую красотку то, что Жемчугов был женат.

Глеб провел с девушкой страстную ночь в женской спальне, а утром, вернувшись к законной супруге, начал распространять про Ефременкову сплетни, обвиняя ее в том, что она отнюдь не соответствует созданному ею образу чистого ангела, а на деле — озлобленная и грубая женщина. После такого признания Юлия отказалась общаться с ним.

Следующие отношения участница ток-шоу попыталась построить с Сергеем Захарьяшем, однако ее постигла неудача. Парень предпочел более спокойную Лизу Полыгалову и перебрался к ней на остров любви. Брюнетка не расстроилась. Очень скоро появилась новая пара — Юлия Ефременкова и Сергей Кучеров. Сережа первым начал проявлять знаки внимания к красивой девушке. Кроме того, он не пытался упрекать ее в ошибках прошлой жизни, что и подкупило страстную красотку.

Они начали встречаться, перебрались на остров любви, где показали зрителям взаимоотношения, в которых ссоры являются достаточно редким явлением. Однако, когда на остров прибыла экс-возлюбленная Кучерова, Ангелина Татишвили, парень не смог устоять и провел с бывшей ночь, после чего вернулся к Ефременковой. Поэтому отношения пары сложно назвать полностью гармоничными.

Тайное становится явным

Есть в биографии Юли Ерфеменковой и темная страница. На телестройке девушка позиционировала себя как порядочную и серьезную девушку, осуждающую разврат. Она нередко негативно высказывалась в адрес тех, кто постоянно меняет половых партнеров. Особенно порицала брюнетка матерей-одиночек и участниц телестройки.

Вот почему для многих ее поклонников стало неожиданностью появление в сети грязных фото- и видеоматериалов, на которых Ефременкова предстала полностью обнаженной, в завлекающих позах. Ее волосы на запретных видеозаписях окрашены в белый цвет. Но факт остается фактом — откровенные интимные фото принадлежат Юлии. Они и стали позорным фактом ее биографии.

Поклонники были так возмущены открывшейся темной стороной жизни красотки, что настаивали на удалении участницы с проекта, считая, что эта женщина не может строить любовь перед всей страной. Однако этого не произошло.

Ефременкова не только сохранила свое место, но и стала ведущей шоу «Дом-2. Разбор», где начала давать советы прочим участникам. Таким образом, даже бесстыжее поведение в прошлом сыграло на руку темноволосой знаменитости.

Искусственная красота

Помимо новой квартиры Юлии Ефременковой, многие обсуждают и пластические операции, которыми эта начинающая певица и экс-супруга Тимура Ефременкова пытается улучшить свою внешность. Конечно, пластикой сейчас никого не удивишь. Коллеги Юли по шоу и ведущие также ложились под нож хирурга, например, Виктория Романец, Ольга Бузова, Ксения Бородина.

Есть несколько операций, которые помогли Ефременковой стать более соблазнительной и яркой. Прежде всего, это увеличение бюста. Юношеские фото красотки доказывают, что она по природе обладала весьма скромным размером груди. Сейчас же основным украшением женщины является соблазнительное декольте, притягивающее восхищенные мужские взгляды.

Кроме того, специалисты, сравнившие старые и новые фото звезды телестройки, отметили, что грудь — не единственное, что изменила себе Ефременкова.

Процедур было несколько:

  1. Коррекция подбородка путем введения специального импланта.
  2. Изменение формы носа (ринопластика). Красотка избавилась от широкого носа «картошкой», придав ему более изящную и привлекательную форму. Говоря по правде, новый нос очень красит лицо девушки, делая его более интересным.
  3. Татуаж губ и бровей.
  4. Уколы красоты.
  5. Наращивание ресниц и бровей.

Ламинирование,окрашивание и наращивание ресниц в салоне красоты «TESORO». Мастера Beauty Bar «TESORO», высокопрофессионально выполняют свою работу и пользуются только качественными материалами.

Все это, как считает Юлия, поможет ей добиться известности и наладить свою личную жизнь. Вес красотки составляет всего 49 кг, рост — 164 см. Все данные, чтобы прославиться, у нее есть. Поэтому не исключено, что в последних новостях о ее жизни поклонников ожидает множество сюрпризов.

Загрузка...

ktotakoj.ru

Ведущая «Дома-2» Юлия Ефременкова прокомментировала слухи о том, что выходит замуж за участника шоу

12:08, 08.10.2019

Телезвезда ответила на несколько вопросов о личной жизни.

Поделиться | Понравилось

Личная жизнь Юлии Ефременковой вновь стала предметом обсуждения. На сей раз появились слухи о том, что ведущая «Дома-2» выходит замуж за участника проекта Мондезира Свет-Амура. Якобы возлюбленный телезвезды сделал ей предложение руки и сердца, на которое та ответила согласием. Сначала 32-летняя знаменитость воздерживалась от комментариев, но, устав от потока вопросов, расставила все точки над i. Так, на вопрос, правда ли, что она выходит замуж, Юлия ответила: «Нет!!! Не верьте слухам!».

Ведущая «Дома-2» Юлия Ефременкова прокомментировала слухи о том, что выходит замуж за участника шоу

Напомним, что Юлия и Мондезир вместе полгода. Участник реалити-шоу долго ухаживал за телеведущей, одаривая ее мягкими игрушками и пышными букетами, и, в итоге, девушка сдалась. В паре царит идиллия, которая лишь иногда нарушается кратковременными ссорами.

«Мне кажется, что у жизни есть такое понятие, как человек-шанс. Он даётся только oдин раз. Приходит для того, чтобы всё изменилось. Чтобы обнять твою душу. Чтoбы вылечить сердце. Чтoбы показать, что всё может быть иначе. Чтобы дать пoнять, что жизнь в которой ты варишься, мoжет быть совершенно другой. Жизнь однажды дарит такoго человека. У которого есть возможность вырвать тебя из негатива, из прoблем, из жизненных «пробок». И когда появляется такой человек, самое главное — не упустить егo, потому чтo, может быть, как раз он и является твоим пропуском в нoвую жизнь», — пишет о возлюбленном ведущая «Дома-2».

Юлия Ефременкова и Мондезир Свет-Амур

В начале февраля Юлия Ефременкова окончательно рассталась с бывшим участником «Дома-2» Сергеем Кучеровым. Отношения пары, которые зародилась в реалити-шоу, были сложными. Молодые люди несколько раз расходились и сходились. Но, как показало время, разные интересы и цели в жизни все же разрушили любовь.

Кстати, в прошлом году Кучеров сделал Ефременковой предложение руки и сердца, на которое она ответила согласием. Позже мужчина покинул телестройку, а Юлия продолжила строить карьеру ведущей. Разница в статусе влюбленных не смутила и роман вспыхнул с новой силой. В определенный момент Ефременкова даже призналась, что готова стать матерью. К слову, некоторые источники называют в качестве причины расставания Юлии и Сергея неверность Кучерова: молодой человек якобы не смог оправдаться после одной из измен, в которой его заподозрила возлюбленная.

Сергей Кучеров и Юлия Ефременкова

Стоит отметить, что у Юлии Ефременковой уже есть опыт семейной жизни. Три года назад она развелась с актером Тимуром Ефременковым. Звезды приняли решение разойтись после восьми лет отношений, четыре года из которых провели в официальном браке. В одном из интервью Юлия рассказала, что ушла от мужа, потому что «Тимур проиграл их любовь». «Мог спустить состояние на развлечения. Может, поэтому у нас и не было детей, боялась рожать. Страшно жить с мыслью, что все можно потерять в любую секунду, хотя бывший муж очень хороший человек и продолжает меня любить», — призналась ведущая «Дома-2».

Юлия Ефременкова с бывшим мужем

Читайте также:

Экс-мужа ведущей «Дома-2» задержали в аэропорту в состоянии алкогольного опьянения

Ведущая «Дома-2» прокомментировала обвинения в изнасиловании в адрес бывшего мужа

Звезды «Дома-2» Юлия Ефременкова и Сергей Кучеров возобновили роман

www.vokrug.tv

Бывшие десантники подрались с росгвардейцами в Москве | Новости из Германии о России | DW

В Парке Горького в Москве в воскресенье, 2 августа, произошла потасовка между бывшими десантниками, отмечавшими там по традиции День ВДВ, и росгвардейцами. Видеозаписи этого происшествия появились в соцсетях.

Так, на видео, опубликованном в Telegram-канале Avtozak Live, видно, как бывшие ВДВ-шники поднимают с земли товарища, у которого разбито лицо, в то время как неподалеку происходит драка между еще одним десантником и росгвардейцем, причем последний пускает в ход дубинку. Оказавшиеся рядом посетители парка и сами ветераны ВДВ в это время снимают происходящее на телефоны.

Почему произошел конфликт в Парке Горького

Как сообщает телеканал "Дождь" со слов одного из очевидцев, десантники возмутились тем, что сотрудники ОМОН "на одного толпой нападают и крутят".

В свою очередь агентство "Интерфакс" со ссылкой на источник указывает, что конфликт произошел после того, как десантников попросили "вести себя скромнее и не размахивать флагом ВДВ, мешая окружающим". После столкновений между бывшими десантниками с сотрудниками ОМОН в Парке Горького были задержаны четыре человека, отмечает агентство. 

Вечером того же дня, 2 августа, директор Парка Горького Павел Трехлеб опроверг сообщения о массовой драке между росгвардейцами и экс-десантниками. По его словам, в парке произошел "небольшой конфликт между посетителями и сотрудником полиции".

"Никакой массовой драки в парке не было абсолютно. Был небольшой конфликт между посетителем и сотрудником ОМОН, полиция вмешалась. Самого активного участника отвели в сторону, его товарищи попытались "присоединиться", но после разъяснительной беседы конфликт был исчерпан, все его участники отпущены", - цитирует Трехлеба агентство ТАСС.

Бывшие десантники на протестах в Хабаровске

2 августа по всей России празднуют День воздушно-десантных войск. В 2020 году "голубые береты" отмечают 90-летний юбилей.

В Хабаровске в этот день многие из ветеранов ВДВ, вышедших на центральные улицы города, присоединились к очередному шествию в поддержку арестованного экс-губернатора края Сергея Фургала.

Смотрите также:

  • Национальные гвардии мира: что это такое и для чего они нужны

    Национальная гвардия

    18 мая 2016 года Госдума приняла в первом чтении законопроект о создании Национальной гвардии в России. Ранее, в апреле, о формировании Нацгвардии объявил президент РФ Владимир Путин. Структуры с аналогичным названием были и есть также в некоторых других странах мира, например, в США, Франции, Португалии, Грузии, на Украине. Что их объединяет?

  • Национальные гвардии мира: что это такое и для чего они нужны

    Нацгвардия Russian Edition

    Российская Национальная гвардия создается на базе внутренних войск МВД. Возглавит новую структуру Виктор Золотов, который с 2000 по 2013 гг. руководил Службой охраны президента. Гвардейцы будут напрямую подчиняться Путину, смогут при необходимости без предупреждения открывать огонь и проникать в жилые помещения. Официально главная задача - борьба с терроризмом и организованной преступностью.

  • Национальные гвардии мира: что это такое и для чего они нужны

    Франция: дитя французской революции

    Первая в мире Нацгвардия - дитя Великой французской революции. Стихийно созданная после взятия Бастилии в 1789 г., она оставила противоречивый след в истории. Французские гвардейцы в разное время подавляли антимонархические (а позже, и монархические) восстания и сами участвовали в них, а в какой-то момент даже возглавляли временное правительство. Нацгвардия Франции была упразднена в 1871 г.

  • Национальные гвардии мира: что это такое и для чего они нужны

    Украина: в чрезвычайных обстоятельствах

    На Украине Национальную гвардию создали после развала СССР, в 1991 г., но спустя 9 лет ее распустили. Воссоздание этой структуры произошло на фоне крымских событий в марте 2014-го, когда стало понятно, что украинская армия и правоохранительные органы не справляются со своими задачами. Впоследствии гвардейцы оказали заметную помощь силам регулярной армии в ходе конфликта на Востоке Украины.

  • Национальные гвардии мира: что это такое и для чего они нужны

    США: американский резерв

    Нацгвардия США основана в 1903 г., ее формирования есть во всех штатах. Подчиняются они как местным, так и федеральным властям. Гвардейцы - организованный резерв вооруженных сил США. Их задействовали, например, для охраны порядка после теракта 9/11, устранения последствий урагана Катрина, а также в войне в Ираке. Служба в Нацгвардии добровольная, совмещается с работой по основной специальности.

  • Национальные гвардии мира: что это такое и для чего они нужны

    Грузия: помощь при ЧП

    Нацгвардия в Грузии появилась в декабре 1990 г., и впоследствии она послужила основой создания регулярных вооруженных сил независимой страны. Гвардейцы принимали активное участие в гражданской войне в Грузии начала 1990-х, причем с обеих сторон. В 2000 г. структуру реорганизовали - теперь она отвечает за армейский призыв и готова прийти на помощь правительству при чрезвычайных ситуациях.

  • Национальные гвардии мира: что это такое и для чего они нужны

    Кипр: национальная армия

    На Кипре Национальной гвардией именуют вооруженные силы этой республики, появившиеся у нее вместе с обретением независимости в 1960 г. Сюда относятся сухопутные войска, военно-морские и военно-воздушные силы страны. В республике действует всеобщая воинская повинность, срок службы составляет два года.

  • Национальные гвардии мира: что это такое и для чего они нужны

    Португалия: почти полицейские

    Португальская Нацгвардия появилась в 1911 году, хотя предшествовавшие ей структуры с иными названиями существовали в стране еще с начала 19 века. Здесь Нацгвардия - это военизированная полиция, организованная по примеру французской жандармерии. Она обеспечивает порядок преимущественно в сельской местности, частично занимается охраной правительственных зданий и таможенным контролем.

  • Национальные гвардии мира: что это такое и для чего они нужны

    Саудовская Аравия: "белая армия"

    Королевская Нацгвардия Саудовской Аравии была основана в 1917 г. и получила прозвище "белая армия" за то, что некогда предпочитала традиционное арабское платье западной военной униформе. Нацгвардию здесь нередко используют для подавления протестов. Гвардейцы отвечают также за борьбу с терроризмом и охрану священных Мекки и Медины. Отдельное подразделение обеспечивает защиту королевской семьи.

  • Национальные гвардии мира: что это такое и для чего они нужны

    Нацгвардии других стран

    Еще Национальные гвардии есть в Бахрейне, Венесуэле, Индии, Кувейте, Латвии, Мавритании, Пакистане, Тунисе, Узбекистане, Эстонии. В разное время они существовали также в Австрии, Венгрии, Ираке, Никарагуа, Панаме и Хорватии. Каждая, несмотря на единое название, - со своей историей возникновения, задачами и спецификой.

    Автор: Илья Коваль


влияние ведущих кодонов

Abstract

Первые триплеты кодирующей области мРНК влияют на выход трансляции. Мы применили метод flowseq для анализа> 30 000 вариантов кодонов 2–11 флуоресцентного белка-репортера для выявления факторов, влияющих на синтез белка. Хотя отрицательное влияние вторичной структуры мРНК на трансляцию было подтверждено, положительная роль редких кодонов в начале кодирующей последовательности для экспрессии генов не наблюдалась.Идентичность триплетов, проксимальных к стартовому кодону, вносит больший вклад в выход белка, чем более удаленных. Дополнительные стартовые кодоны в рамке считывания усиливают трансляцию, тогда как мотивы, подобные Шайну-Далгарно, расположенные ниже инициирующего кодона, являются ингибирующими. Стоимость метаболизма аминокислот влияет на выход белка в бедной среде. Наиболее эффективная трансляция наблюдалась для вариантов с характеристиками, напоминающими нативные гены Escherichia coli .

ВВЕДЕНИЕ

Механизмы, определяющие эффективность трансляции, имеют фундаментальное значение для нашего понимания экспрессии генов и распределения внутриклеточных ресурсов.Не менее важны эти знания для оптимизации экспрессии экзогенных генов в биотехнологии. Несмотря на десятилетия исследований, правила, регулирующие эффективность перевода, до сих пор остаются спорными. Было высказано предположение, что некоторые особенности кодирующей последовательности вносят вклад в выход белка. Сворачивание кодирующей области мРНК рядом со стартовым кодоном может препятствовать связыванию рибосом и часто рассматривается как первичный детерминант эффективности трансляции (1–5). Видоспецифической (6,7) особенностью является использование синонимичных кодонов, численно выраженное в виде индексов адаптации кодонов или тРНК (CAI (7) и tAI (8), соответственно).Более того, использование кодонов значительно варьируется между мРНК, кодируемыми в одном и том же геноме (9,10), и даже вдоль определенной мРНК (11,12). Обычно считается, что обогащение часто используемых кодонов вдоль мРНК улучшает трансляцию (13–15) и стабильность мРНК (13,16), которые необходимы для экспрессии естественных генов, а также для биотехнологических приложений (17,18). Однако компьютерный анализ целого генома ряда видов показал, что 5'-большая часть кодирующей области, называемая ramp , в среднем характеризуется более низким tAI (11,19), более частым возникновением кодоны для положительно заряженных аминокислот (19) и неравномерное распределение элементов вторичной структуры (20).Было выдвинуто предположение, что медленная трансляция области рампа снижает коллизии рибосом ниже по течению (11,20).

Анализ защищенных рибосомами фрагментов мРНК (riboseq) (21) выявил повышенную плотность рибосом в начале кодирующих областей, что первоначально интерпретировалось как доказательство медленно транслируемой рампы (11), хотя позже это было объяснено повышенной инициацией ставки для коротких ORF (3). Смещение в сторону положительно заряженных аминокислот в начале кодирующих областей объяснялось специфическими требованиями к последовательности для трансмембранных белков (22), в то время как более низкий CAI рамповой области приписывался отбору против стабильных вторичных структур, секвестрирующих сайты связывания рибосом (1) у видов где редкие тройни богаты АЕ (23,24).

Многочисленные разногласия связаны с общим пониманием факторов, которые замедляют продвижение рибосом вдоль мРНК, таких как кодоны, распознаваемые редкими видами тРНК (11,25), триплеты, требующие декодирования колебаниями (26,27), Шайн-Далгарно (SD) -подобные сайты (28,29) и кодоны для определенных аминокислот (27–29). Некоторые трудности затрудняют идентификацию особенностей кодирующей последовательности, которые влияют на продукцию белка. Вычислительный анализ последовательностей мРНК не позволяет выявить причину смещения конкретной последовательности, будь то выбор в пользу эффективности трансляции конкретной мРНК, экономия ресурсов для трансляции других мРНК или другие причины.Прямая оценка эффективности трансляции естественных мРНК с помощью riboseq дала множество данных, но ограничение пространства выборки ограниченным числом генов, закодированных в геноме, затрудняет оценку вклада каждого фактора в выход белка на мРНК.

Метод flowseq оказался эффективным инструментом для оценки влияния различных характеристик мРНК на биосинтез белка (1,2,30–32) в одном массовом параллельном эксперименте. Предыдущие применения этого метода включали множество экспериментальных планов.После новаторской работы Kudla et al. (2), значимость детерминант кодирующей области для выхода трансляции была рассмотрена с помощью библиотеки из 137 вариантов первых 10 кодонов, полученных из природных генов Escherichia coli (1), набора из 244000 репортеров, содержащих большие 96-нуклеотидные области мРНК, предназначенные для равномерного представления возможных комбинаций признаков, которые, как известно, влияют на трансляцию (32), и набор из 259 134 репортеров, созданный для исчерпывающей выборки пространства последовательностей кодонов 3-5 (31).Наши предыдущие исследования полагались на двойной флуоресцентный белковый репортер (33) для оценки влияния области мРНК 5'-UTR на эффективность трансляции для рационально разработанных (34) и рандомизированных (30) библиотек плазмид. Здесь мы применяем конвейер flowseq для анализа влияния кодонов 2-11 на результат трансляции, стремясь дополнить ранее опубликованные усилия (1,31,32).

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы

Для процедур клонирования использовали штамм Escherichia coli JM109.BW25113 и ΔArg (производное BW25113, созданное путем замены argY , argZ и argQ на kanR , кассета устойчивости к канамицину, в соответствии с экспериментами по сортировке клеток Даценко – Ваннера (35).

Конструирование репортерных плазмид и рандомизированной библиотеки репортерных конструкций

Плазмида pRFPCER (33) была разрезана с помощью BsmBI и лигирована с дуплексом ДНК, полученным отжигом олигонуклеотидов 5'– TGAAAGAGACGGACGAGATAGCGGAT′ – TCCGTCGTC и 5GCCGTC .В результате сайт BamHI был вставлен ниже стартового кодона ATG для получения pRFPCER2. Подготовка библиотеки была выполнена, как описано ранее (30), pRFPCER2 был переварен с помощью SacII и лигирован с дуплексом ДНК, полученным отжигом олигонуклеотидов 5'– CACACAACACCGGAGCAACTATG – 3 'и 5′ – AGCTTACGGATCCNNNTNNGATCCNNNNGTNNNGTNNNNNNNNNNNNGNNNNNNNNNGNNNNNNNNGNCCNNNNNGNCCNNNNNNNCCCNNNNNNNCCCNNNNNNNCC Фрагмент Кленова использовали для синтеза комплементарной цепи рандомизированной части. Линеаризованная плазмида с двумя рандомизированными дуплексами на концах расщеплялась BamHI и подвергалась циркуляризации путем самолигирования.В результате рандомизированная часть 30N была вставлена ​​сразу после стартового кодона ATG.

Штамм Escherichia coli JM109 электропорировали с помощью полученной библиотеки с эффективностью 10 6 –10 7 КОЕ / мкг ДНК, и клетки выращивали в течение ночи в среде LB с ампициллином. Плазмидную библиотеку очищали с помощью системы PureYield ™ Plasmid Miniprep (Promega). Штаммы BW25113 или ΔArg электропорировали библиотекой и выращивали в течение ночи в среде LB или M9 с добавлением ампициллина перед сортировкой клеток.

Плазмиду pRFPCER2 подвергали ПЦР со следующими олигонуклеотидами: LguI rev TCTCTTTCAGGCGCTCTTCTCATAGTTGCTCCGGGTGTTG

BamHI F CGGACGAGAGGCGGATCCCTGAAAGAGAGACG с помощью кольцевого связывания -CGGGATCCCTGAAAGAGACG самостоятельно -CGGATCCCTGAAAGAGACG. Полученную плазмиду pRFPCER3 расщепляли ферментами BamHI и LguI. Затем расщепленную плазмиду смешивали со 160 предварительно отожженными олигонуклеотидами (см. Дополнительную таблицу S2 для последовательностей вариабельной части полученных кодирующих областей) и лигировали. Ячейки E.coli штамм JM109 трансформировали продуктами лигирования, полученные плазмиды подтверждены секвенированием.

Сортировка клеток

Ночные культуры клеток дважды промывали стерильным PBS и сортировали с помощью сортировщика клеток BD FACSAria TM III, около 2,5 миллионов клеток анализировали и сортировали в 12 бункеров в соответствии с соотношением CER и RFP. Отсортированные клетки выращивали в течение ночи в среде LB с ампициллином и использовали для очистки плазмид и измерения флуоресценции, как описано ранее (30).

Приготовление библиотек ампликонов и секвенирование

1 нг плазмид из каждой фракции использовали для ПЦР-амплификации со штрих-кодированными олигонуклеотидами, комплементарными постоянной части плазмид, окружающей рандомизированную часть. Качество ПЦР оценивали с помощью агарозного геля. Библиотеку с парными концами получали из объединенных ампликонов со штрих-кодом с использованием набора для подготовки библиотеки ДНК NEBNext Ultra для Illumina (NEB). Глубокое секвенирование ампликона проводили на геномном секвенаторе MiSeq (2 × 300 циклов, Illumina) в Genomics Core Facility СО РАН (ИЦБФМ СО РАН, Новосибирск, Россия).Постоянные области при чтении были удалены с помощью CUTADAPT (36). Данные чтения, представленные в этом исследовании, были отправлены в GenBank под номером исследования PRJNA476703 и образцом доступа SRS3434030.

Вызов варианта

Все необработанные считывания короче 140 и длиннее 155 нуклеотидов были удалены. Мы выбрали чтения, которые содержали постоянные части ампликонов от ATG до AGA для прямого чтения и от TCT до CAT для обратного чтения, которые были преобразованы в дополнительные прямые чтения для дальнейшего анализа.Все считывания без детектируемой или с более чем одним появлением константной части, а также последовательности с повторяющимися нуклеотидами были удалены. Все остальные последовательности, содержащие ожидаемые константные части, фланкирующие специфические последовательности рандомизированной области, были сгруппированы по образцам, репликам и фракциям в соответствии со штрих-кодами.

Исправление ошибок

После вызова варианта было подсчитано появление каждого варианта в 12 ячейках. Мы применили процедуру исправления ошибок из нашей предыдущей работы (30).Вкратце, было подсчитано общее количество всех вариантов последовательности, и варианты были разделены на редких, (четыре или менее случаев) и обычных (пять или более случаев) в соответствии с эмпирическим порогом частоты, равным 4. Расстояния между общими вариантами были рассчитывается таким образом, чтобы любое несоответствие, вставка или удаление, которое необходимо для преобразования одной последовательности в другую, увеличивало расстояние на 1. Было отмечено, что расстояния между последовательностями делятся на две группы, будучи меньше или равными 6 и 20 или более (Дополнительные Рисунок S1E).Наша интерпретация заключалась в том, что близкородственная группа последовательностей, разделенных расстоянием в шесть или меньше, на самом деле была одним вариантом последовательности, размытым из-за ошибок ПЦР и секвенирования. Таким образом, для каждой группы вариантов, разделенных расстоянием шесть или меньше, мы выбрали наиболее распространенный вариант и переназначили вхождения всех других близкородственных общих и редких чтений этому варианту. Наконец, если редкий вариант при заданном пороге не был похож ни на один из распространенных, он включался в набор данных без объединения.После исправления ошибок ПЦР и секвенирования полученное распределение сходства было статистически неотличимым ( P -значение = 0,22) от идеальной рандомизации (дополнительный рисунок S1F).

Вычисление и фильтрация фракций

Доля эффективности трансляции (TEF) была присвоена вариантам после ссылки. (30). Вкратце, если один и тот же вариант последовательности может быть найден в нескольких ячейках, отсортированных по соотношению CER / RFP, мы вычислили среднее значение ячейки в гауссовском приближении.Мы рассчитали долю появления вариантов в среднем интервале и соседних интервалах и отброшенных вариантах последовательностей с более чем 20% случаев за пределами этого пика, предполагая, что эти варианты последовательности были распределены слишком широко. Мы также отбросили варианты последовательностей, средние интервалы которых в двух повторностях отличались на два или более. Поскольку количество вариантов в ячейках сильно различается, а в некоторых из них было недостаточно для преодоления статистического шума, четыре ячейки с максимальной эффективностью были объединены, а оставшиеся ячейки были объединены в группы по два, таким образом, сформировав окончательные пять долей эффективности перевода ( ТЭФ).

Все нуклеотидные последовательности транслировались согласно стандартному генетическому коду (только одна рамка), все варианты со стоп-кодонами были отфильтрованы. Гены, кодирующие белок, были отобраны с использованием аннотации генома {"type": "entrez-nucleotide", "attrs": {"text": "NC_000913", "term_id": "556503834", "term_text": "NC_000913"}} NC_000913.v2. Та же самая область, охватывающая положения нуклеотидов 4–33, была использована для сравнения с TEF.

Статистический анализ

Расчет вторичной структуры РНК

Для расчета энергии сворачивания РНК мы собрали каждый вариант как UTR + AUG + 30NT + постоянную часть, где последовательность UTR - AGAAGGAGAUAUCAU, AUG - стартовый кодон, 30NT - 30 нуклеотидов варианта рандомизированной части, а константная часть - GGAUCCCUGAAAGAGACGGACGAGAGCGGCCUGGUGAGCAAGGGCGAGGA.Затем запускаем RNAfold ver. 2.1.7 из пакета Vienna RNA для расчета энергии сворачивания dG с параметрами по умолчанию (37).

Расчет SD-подобия

Для каждого гексамера варианта его SD-подобие рассчитывали как свободную энергию гибридизации с анти-SD последовательностью CACCUCCU в 16S рРНК с использованием RNAfold из пакета Vienna RNA (37). Каждому варианту была присвоена минимальная энергия гибридизации составляющих гексамеров.

Расчет метаболической стоимости

Для каждого положения кодона 2–11 в каждой фракции мы рассчитали среднюю метаболическую стоимость кодируемой аминокислоты.Метаболические затраты на биосинтез аминокислот были взяты из исх. (38).

Случайное перемешивание

Чтобы учесть смешанные эффекты неравномерных частот нуклеотидов в TEF, мы построили 10 000 наборов перемешанных вариантов. Для этого мы случайным образом переставляли нуклеотиды в каждой позиции отдельно для каждой фракции. Следовательно, мы сохранили исходные позиционные частоты нуклеотидов в каждом классе, нарушив другие функции, такие как кодоны, структуры РНК и т. Д. Таким образом, мы получили набор перетасованных наборов данных мРНК, которые сохраняли частоты нуклеотидов в каждой позиции кодирующей области для каждого TEF, в то время как последовательности были рандомизированы.Мы повторили все анализы этих перемешанных наборов данных и использовали результаты для оценки статистической значимости наших наблюдений. Это сравнение позволило нам оценить, была ли функция, зависящая от последовательности, обогащена конкретным TEF исключительно за счет нуклеотидного состава TEF.

Сравнение распределений

Для каждого TEF были построены распределения энергии сворачивания РНК и SD-подобия, а также распределения для всех классов вместе взятых. Нижний квартиль комбинированного распределения использовался в качестве порогового значения.Таким образом, распределение в каждой фракции было разделено на головную (выше порога) и хвостовую (ниже пороговой) части. Затем мы вычислили значение χ 2 для таблицы непредвиденных обстоятельств 2 × 5 (размер головы / хвоста в зависимости от фракции). Та же процедура была выполнена для перетасованных наборов данных. Статистическая значимость рассчитывалась как доля перетасованных последовательностей, имеющих χ 2 больше, чем наблюдаемое значение, или 10 -4 , если ни одна из перетасованных последовательностей не имела более высокого χ 2 .Достоверность различия с набором из генов E. coli оценивалась аналогичным образом с помощью таблицы сопряженности 2 × 2 (размер головы / хвоста по сравнению с данной фракцией / E. coli ).

Влияние кодонов и аминокислот

Для каждого кодона в каждом положении 2–11 мы рассчитали частоту позиционных кодонов в каждом TEF. Мы сохранили только те пары кодон + положение, для которых частота монотонно зависела от дроби (абсолютное значение коэффициента корреляции Спирмена больше 0.8; монотонных кодонов или пар ). Эффект кодона в данном положении рассчитывали как коэффициент линейной регрессии частоты положения кодона на число фракции; для немонотонных пар эффект полагался равным нулю. Затем мы рассчитали эффекты в перетасованных наборах данных и вычислили P -значение и Z -счет наблюдаемого значения относительно построенного распределения, как описано в двух предыдущих параграфах, отдельно для каждой пары кодон + положение.

Эффект аминокислот рассчитывали как взвешенную сумму эффектов кодонов, кодирующих эту аминокислоту, с весами, равными частотам этих кодонов в генах E. coli . Эффект положения рассчитывали как среднее абсолютное значение эффектов всех монотонных кодонов в этом положении.

Код, использованный для анализа, доступен по адресу https://github.com/homo-sapiens34/leading-codons.

Определение отношения РНК / ДНК для рационально сконструированных репортерных плазмид

Подготовленные плазмиды смешивали в эквимолярном соотношении и использовали для трансформации клеток штамма BW25113.В результате было получено более 10 5 индивидуальных клонов. Смесь полученных клонов выращивали до средней логарифмической фазы (A 600 = 0,5) и использовали для получения плазмидной ДНК и тотальной РНК. кДНК получали обратной транскрипцией полной РНК с олигонуклеотидом CGGACACGCTGAACTTGT. Ампликоны для секвенирования получали с помощью ПЦР из плазмидной ДНК или кДНК с олигонуклеотидами CGGACACGCTGAACTTGT и CACACAACACCGGAGCAAC и подвергали секвенированию, как описано выше.

Рациональный дизайн последовательностей-мишеней

Чтобы подтвердить эффекты, выявленные при анализе данных flow-seq, мы разработали набор последовательностей-мишеней, помещенных как кодоны 2–11 в репортерную конструкцию для экспериментальной проверки.Для каждой протестированной функции мы разработали набор последовательностей, изменяя эту функцию, сохраняя неизменными остальные функции.

Чтобы проверить позиционные эффекты конкретных кодонов, мы использовали набор последовательностей, содержащих один, два или три кодона, которые, как предполагается, окажут негативное влияние на трансляцию, если они присутствуют в определенной позиции спейсера. Последовательности не имели дополнительных стартовых кодонов, SD-подобных областей, и все имели прогнозируемую энергию сворачивания РНК 15,8 ± 1,7 ккал / моль. Аналогичным образом, еще два набора использовали для проверки влияния положения SD-подобных последовательностей и дополнительных стартовых кодонов.Наконец, чтобы изучить влияние стоимости метаболизма аминокислот, мы протестировали две пары последовательностей с почти эквивалентным содержанием кодонов и энергией сворачивания, при этом варьируя стоимость кодируемых аминокислот.

Полный список разработанных целевых последовательностей представлен в дополнительной таблице S2.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Создание репортерной библиотеки и анализ flowseq

Чтобы проанализировать влияние области рампы на эффективность синтеза репортерного белка, мы вставили 30-нуклеотидную рандомизированную область (кодоны 2–11) непосредственно после Стартовый кодон ATG гена флуоресцентного белка Cerullian (CER) в репортерной конструкции (30,33,34), который дополнительно содержал ген красного флуоресцентного белка (RFP), используемый в качестве внутреннего контроля (рисунок).Хотя теоретически возможное количество рандомизированных вариантов последовательности из 30 нуклеотидов, 4 30 , намного превышает возможности экспериментального анализа, трансформация хозяина E. coli ограничила сложность библиотеки до 5 × 10 6 независимых клонов. Полученная в результате библиотека в дубликате была отсортирована на пять фракций по эффективности трансляции CER, связанной с эффективностью RFP (доли эффективности трансляции, TEF; рисунок, дополнительный рисунок S1A), и подверглась секвенированию следующего поколения (NGS) для определения последовательностей рандомизированной области.В целом, 32 376 вариантов рамповой последовательности (дополнительная таблица S1) были обнаружены в обеих репликах библиотеки (дополнительный рисунок S1B) и рассмотрены для дальнейшего анализа, таким образом представляя разнообразие рамповых областей, резко превышающее разнообразие природных E. coli . гены и сопоставимы с более ранними наборами данных, исследованными flowseq (1,31,32). Реплики продемонстрировали относительно хорошую воспроизводимость, так что похожие варианты мРНК обычно обнаруживаются в пределах одного или непосредственно соседних бункеров (дополнительный рисунок S1B).Измерение флуоресценции CER и RFP в отсортированных фракциях (дополнительный рисунок S1C) продемонстрировало хорошее соответствие с результатами анализа FACS. Большинство рандомизированных последовательностей продемонстрировали средний выход трансляции, в то время как эффективно транслируемые и полностью неактивные варианты мРНК были на порядок менее многочисленными (дополнительный рисунок S1D).

Принципиальная схема эксперимента flowseq. ( A ) Сверху вниз: построение библиотеки, преобразование E.coli библиотекой плазмид, сортировка по флуоресценции CER / RFP на пять TEF, секвенирование. ( B ) Скрипичный график распределений свободной энергии сворачивания РНК в пяти TEF и в естественных генах E. coli , P -значение <10 -4 (случайное перемешивание, см. Методы, статистический анализ) .

Последовательности со стоп-кодонами в рамке считывания были обнаружены преимущественно в TEF 1–2 (дополнительный рисунок S2A), которые характеризуются самой низкой эффективностью трансляции.Перед дальнейшим анализом такие последовательности были отфильтрованы.

Анализ энергии сворачивания вариантов мРНК CER (рисунок) выявил, в соответствии с более ранними исследованиями (1,2,4,5,23,25), пониженную стабильность вторичных структур в эффективно транслируемых мРНК, близкую к таковой. в генах E. coli . В соответствии с этим наблюдением наблюдалось значительное смещение нуклеотидного состава области наклона пулов мРНК CER, различающихся соотношением экспрессии CER / RFP (дополнительный рисунок S2B).Эффективно транслируемые мРНК были обогащены аденинами и в меньшей степени уридинами в рандомизированной области. Наблюдаемое распределение близко к смещению нуклеотидного состава области кодонов 2-11 природных ORF E. coli (дополнительный рисунок S2B, крайняя правая полоса). Обогащение A и U на 5'-конце эффективно транслируемых ORF было обнаружено и в других экспериментах flowseq (1,31,32).

Композиционный сдвиг рамповой области эффективно транслируемых мРНК, вероятно, отражает потребность в слабой вторичной структуре.Поскольку другие характеристики кодирующей области, такие как состав кодонов, CAI / tAI и вероятность спаривания с 3'-концевой областью 16S рРНК, как ожидается, будут зависеть от нуклеотидного состава, чтобы компенсировать влияние последнего, мы создали десять тысяч рандомизированных наборов данных того же размера, что и набор данных flowseq, и с сохранением частотно-зависимых нуклеотидов, наблюдаемых в каждом TEF (материалы и методы, статистический анализ, случайное перемешивание). Все характеристики мРНК, проанализированные далее, сравнивали с этим рандомизированным набором для оценки их статистической значимости.

Еще одним возможным источником ошибки в интерпретации данных может быть различная стабильность или гипотетически вариабельная эффективность транскрипции вариантов мРНК, обладающих разными кодонами 2–11. Хорошо известно, что в целом особенности всей последовательности мРНК, такие как использование кодонов, влияют на количество мРНК у E. coli (13), дрожжей (39) рыбок данио (40) и человека (16). Чтобы проверить, изменяется ли количество мРНК в масштабе, сопоставимом с соотношением CER / RFP в используемой нами репортерной системе, мы создали репрезентативный набор из ~ .150 репортерных плазмид с комбинациями характеристик мРНК CER в кодонах 2-11, как благоприятных, так и ингибирующих для трансляции (дополнительная таблица S2), и использовали этот набор для трансформации хозяина E. coli . Измерение отношения CER / RFP в этих культурах сопровождалось определением содержания мРНК, нормализованного к соответствующему содержанию ДНК (дополнительный рисунок S2C). Мы наблюдали только незначительные, на один порядок величины, изменения уровня мРНК, в то время как уровни CER / RFP варьировались> 3 порядков на одном и том же наборе репортеров.Таким образом, мы заключаем, что эффективность трансляции, а не количество мРНК, является основным фактором наблюдаемой разницы в выходе флуоресцентного белка в используемой экспериментальной установке. Имея в виду этот результат, мы считаем, что отношения CER / RFP являются разумным приближением к эффективности перевода.

Влияние SD-подобных последовательностей в кодирующей области на эффективность трансляции

Приостановка рибосомы на SD-подобных сайтах в E. coli , первоначально обнаруженная с помощью подхода «рибосек» (28), позже предположительно была артефактом процедура пробоподготовки (29).Чтобы проверить, могут ли такие последовательности в рамповой области мРНК CER приводить к снижению эффективности трансляции, мы проанализировали наличие подпоследовательностей, комплементарных 3'-концевой области 16S рРНК для всех мРНК в наборе данных (рисунок). Снижение встречаемости SD-подобных участков в рамповой области эффективно транслируемых мРНК демонстрирует их негативное влияние на биосинтез белка, подтверждая более ранние наблюдения, полученные с ограниченным набором модельных мРНК (41). Это наблюдение является надежным после учета нуклеотидного состава (значение P <10 -4 ).Примечательно, что распределение энергий связывания анти-SD в высокоэффективных TEF сходно с распределением генов E. coli (рисунок, крайний правый график).

Влияние SD-подобных последовательностей в начале кодирующей области на эффективность трансляции. ( A ) Скрипичный график распределений энергии потенциального спаривания оснований с 3'-концевой областью 16S рРНК в пяти TEF и в природных генах E. coli , P -значение <10 -4 (случайное перемешивание, см. «Методы, статистический анализ»).Пунктирная линия: нижний квартиль комбинированного распределения для всех TEF. ( B ) Трансляционная эффективность разработанных конструкций. Схематическое изображение (левая часть панели) и эффективность перевода (правая сторона панели) конструкций. Все обозначения конструкций указаны рядом со схематическими изображениями. SD-подобные последовательности показаны в красных прямоугольниках. Эффективность трансляции репортера CER была нормализована к эталонной конструкции RFP и указана в виде диаграммы.Точные значения отображаются рядом с соответствующими полосами. Последовательности перечислены в дополнительной таблице S2.

Чтобы подтвердить предсказанное влияние SD-подобных последовательностей на 5'-конце кодирующей области на продукцию белка CER, мы разработали и создали набор репортерных конструкций с AGGAGG SD-подобной последовательностью, размещенной в положениях нуклеотидов 4–28. кодирующей области (рисунок, левая часть; точные последовательности и более подробные данные см. в материалах и методах, рациональном дизайне целевых последовательностей и дополнительной таблице S2).Чтобы компенсировать влияние вторичной структуры на эффективность трансляции, все репортерные последовательности мРНК были разработаны так, чтобы иметь одинаковую энергию сворачивания –13 ± 0,2 ккал / моль, что соответствует наименее структурированным мРНК в рандомизированном пуле (дополнительный рисунок S3A). Эффективность производства CER / RFP, управляемая этим набором репортеров (рисунок, правая панель), подтвердила наблюдения, основанные на анализе flowseq (рисунок): SD-подобные мотивы в начале трансляции с пониженной регуляцией ORF.Этот эффект нельзя было объяснить размещением определенных кодонов в ORF CER, поскольку он не зависел от положения SD-подобного участка относительно рамки считывания CER. Однако ингибирующие свойства SD-подобной последовательности в кодирующей области зависели от расстояния до стартового кодона (рисунок, сравните отношения CER / RFP для репортеров с SD-положениями от +4 до +28). Этот эффект может быть объяснен секвестрацией сайта связывания рибосомы и стартового кодона за счет остановки рибосом в расположенной ниже SD-подобной последовательности.

Влияние конкретных кодонов на эффективность трансляции

Чтобы оценить вклад кодонов в десяти триплетах, следующих за инициатором AUG, мы рассчитали частоту кодонов, специфичных для положения, для отдельных TEF и сравнили их с рандомизированным набором мРНК. В каждой позиции рассчитывалось количество кодонов, частота которых монотонно зависела (увеличивалась или уменьшалась) от эффективности трансляции. Количество таких кодонов было значительно выше в наблюдаемых данных по сравнению с перетасованными контрольными наборами данных (материалы и методы, статистический анализ, случайное перемешивание; дополнительный рисунок S3B), демонстрируя, что выбор кодонов действительно не является случайным.Затем мы рассчитали влияние таких монотонных кодонов на эффективность трансляции, как коэффициент линейной регрессии частоты на число TEF (Рисунок, левая панель; здесь и ниже см. Материалы и методы, Статистический анализ, Влияние кодонов и аминокислот. для расчетных деталей). Большинство индивидуальных предпочтений кодонов в высокоэкспрессируемых репортерах можно объяснить позиционным нуклеотидным составом, как показано при сравнении с перетасованными контрольными наборами данных (рисунок, правая панель).Однако некоторые триплеты (рисунок, правая панель), а также кодируемые аминокислоты (дополнительный рисунок S4A), по-видимому, являются либо полезными, либо ингибирующими для трансляции даже после учета смещения нуклеотидного состава. Среднее влияние идентичности кодонов на выход белка было выше в AUG-проксимальных положениях и снижалось дальше от стартового кодона (рисунок), в соответствии с позиционной зависимостью смещения использования кодонов в природных мРНК (11,12).

Влияние кодонов 2–11 на эффективность трансляции.( A ) Различия частот триплетов в положениях кодонов 2–11 (столбцы) в зависимости от TEF. Цвет ячейки представляет собой коэффициент линейной регрессии зависимости частоты триплета от номера TEF (слева) или Z-показателя данного кодона в данной позиции (справа). Цвет - зеленый для положительных значений, красный для отрицательных значений (цветовой код показан под панелью). Нулевым (желтым) обозначены кодоны с немонотонной зависимостью частоты от фракции. Ячейки с P -значениями <0.01 заключены в рамку (ожидается шесть таких ячеек на каждой тепловой карте для случайных последовательностей). ( B ) Позиционная специфичность влияния кодона на эффективность трансляции. Показана средняя оценка Z эффектов кодонов в определенной позиции (с поправкой на содержание нуклеотидов, см. Методы). Кодоны с частотами с немонотонной зависимостью от эффективности трансляции исключаются. Пирсона r = -0,8, P -значение = 0,005. ( C , D ) Трансляционная эффективность разработанных конструкций.Схематическое изображение (левая часть панели) и эффективность перевода (правая сторона панели) конструкций. Все обозначения конструкций указаны рядом со схематическими изображениями. Кодоны, ингибирующие экспрессию в конкретном положении согласно анализу данных flowseq, показаны в красных прямоугольниках. Эффективность трансляции репортера CER была нормализована к эталонной конструкции RFP и указана в виде диаграммы. Точные значения отображаются рядом с соответствующими полосами.Последовательности перечислены в дополнительной таблице S2. ( E ) Корреляция влияния кодона на трансляцию для каждого из смысловых кодонов в каждом из исследованных положений мРНК (2–11) и использование кодонов в E. coli . Показан график корреляции кодонного эффекта, который представляет собой коэффициент линейной регрессии × 10 3 зависимости частоты триплета от числа TEF и предпочтения использования кодонов над синонимичными кодонами в E. coli . Пирсона r = 0.33, P -значение = 9,6 × 10 −9 . ( F ) То же, что и в (E), но вместо коэффициентов корреляции показаны баллы Z , так что данные корректируются с учетом частот нуклеотидов. Пирсона r = -0,12, P -значение = 0,004.

Чтобы подтвердить прогнозируемый положительный или отрицательный эффект конкретных кодонов в положениях 2-11 на выход белка, мы разработали набор конкретных репортерных плазмид (материалы и методы, рациональный дизайн последовательностей-мишеней и дополнительная таблица S2).Чтобы избежать смешанных эффектов, во всех разработанных репортерах сродство нуклеотидов +4 - +33 кодирующей области CER к 3'-концевой области 16S рРНК было минимизировано, в то время как энергия сворачивания вторичной структуры в репортерной мРНК была в пределах –15,8 ± 1,7 ккал / моль. В этих сконструированных репортерах большинство кодонов 2-11 были оптимальными по положению в соответствии с анализом данных flowseq, в то время как введение одного, двух или трех кодонов, которые, по прогнозам, ингибируют выход белка, в соответствующие положения области рампы.Замена оптимального кодона на ингибирующий в положениях 2, 3, 4, 6, 7, 8, 9 и 10 кодирующей области CER (рисунок, схема слева) приводила к снижению продукции CER / RFP для ряда конструкций (рисунок, правый график). Было обнаружено, что размещение ингибирующих кодонов на сайтах, которые в среднем ближе к началу ORF (+2, +3, +4 и +7), снижает синтез белка, в то время как этот эффект был незначительным для более дистальных сайтов (+6 , +8, +9 и +10). Этот результат подтвердил тенденцию, наблюдаемую с flowseq (Рисунок, B).Поскольку влияние одного ингибирующего кодона на экспрессию репортерного гена было умеренным (рисунок), мы проверили, будут ли два или три таких кодона аддитивно подавлять экспрессию (рисунок, левая схема), и обнаружили, что это именно так (рисунок, правый график). . Подобно одиночному неблагоприятному кодону, пары (дополнительная фигура S4B) и тройки (дополнительная фигура S4C) таких кодонов подавляли экспрессию в среднем более эффективно при размещении ближе к началу стартового кодона.

Ранее сообщалось, что использование кодонов (11) и встречаемость аминокислот (19) в N-концевой части природных белков являются предвзятыми, тогда как происхождение этого предубеждения было предметом споров (1,22,25). .Отрицательное влияние кодонов GGA, GGG, AGG (рисунок) может быть вызвано их сходством с последовательностью SD. Ингибирующий эффект конформационно гибких (Gly) или ограниченных (Pro) остатков (дополнительный рисунок S4A) напоминает данные о задержке рибосомы на сайтах, содержащих эти остатки в различных положениях относительно P-сайта (29,42,43). Маловероятным предостережением для этого анализа является возможность того, что добавление некоторых конкретных N-концевых удлинений к флуоресцентному белку может повлиять на его флуоресценцию.

Очевидно полезная роль метионина среди аминокислот 2–11 для эффективности трансляции (рисунок, линии AUG, дополнительный рисунок S4A, линия M), вероятно, объясняется использованием дополнительных кодонов AUG в качестве вспомогательных сайтов инициации трансляции. Чтобы проверить это предположение, мы создали набор репортерных конструкций, содержащих в основном неблагоприятные для экспрессии кодоны в положениях 2–11, при сохранении сходной энергии сворачивания вторичной структуры РНК на уровне –24 ккал / моль. В этом наборе репортеров триплеты AUG были помещены в кодирующую область CER в положениях от +4 до +30 с шагом в один нуклеотид (рисунок, левая схема, кодоны AUG в кадре окрашены в зеленый цвет).Выход белка CER действительно был в среднем немного выше, если положение кодона AUG совпадало с рамкой считывания CER (положения +4, +7, +10, +13, +16, +19, +22, +25 и +28 ) по сравнению с расположением вне кадра (позиции +5, +6, +8, +9, +11, +12, +14, +15, +17, +18, + 20, + 21, +23, + 24, +26, +27, +29 и +30). В целом, набор данных в кадре отличался от набора данных вне кадра с P -значение = 0,018 (тест Манна – Уитни).

Влияние дополнительных кодонов AUG в области мРНК рампы на выход трансляции.Схематическое изображение (левая часть панели) и эффективность перевода (правая сторона панели) конструкций. Все обозначения конструкций указаны рядом со схематическими изображениями. Показаны кодоны AUG. Красные прямоугольники соответствуют кодонам AUG вне кадра, а кодоны в кадре CER показаны зелеными прямоугольниками. Эффективность трансляции репортера CER была нормализована к эталонной конструкции RFP и указана в виде диаграммы. Точные значения отображаются рядом с соответствующими полосами.Последовательности перечислены в дополнительной таблице S2.

Влияние оптимальности кодонов на эффективность трансляции

Наиболее спорным вопросом является предлагаемый отбор редких кодонов в рамповой области природных мРНК (1,3,11,20), который можно альтернативно интерпретировать как следствие отбор против образования устойчивой вторичной структуры (23,24). Мы наблюдали, что влияние позиционно-специфичных кодонов на экспрессию репортера положительно коррелирует с использованием кодонов в нативном E.coli (рисунок), хотя эта корреляция полностью исчезает после поправки на позиционные частоты нуклеотидов (рисунок). Никакой корреляции не наблюдалось при сравнении эффектов кодона и кодона tAI (8) (дополнительный рисунок S4D).

Чтобы напрямую рассмотреть возможность влияния tAI рамповой области на эффективность трансляции независимо от других параметров, мы создали штамм ΔArg E.coli , в котором мы удалили три из четырех генов, кодирующих тРНК Arg ACG ( Рисунок), что привело к ~ 5-кратному снижению численности тРНК Arg ACG (дополнительный рисунок S5A).Таким образом, мы уменьшили tAI эффективно транслируемых кодонов CGU, CGC и CGA в пять раз. Мы трансформировали штамм ΔArg той же библиотекой репортерных плазмид, которая использовалась для трансформации штамма дикого типа, и отсортировали клетки аналогичным образом (дополнительная таблица S3, рисунок S5B, C). Влияние каждого кодона на эффективность трансляции рассчитывали, как для штамма дикого типа, и использовали для сравнения (рисунок; см. Дополнительный рисунок S5D для Z -счетов). По-видимому, пятикратное снижение tAI не привело к значительным изменениям влияния кодонов CGU, CGC и CGA на биосинтез белков.

B. Влияние тРНК Arg количества копий гена ACG на трансляцию репортеров CER. ( A ) Схема оперона serV у дикого типа и в штаммах ΔArg. ( B ) График разброса коэффициентов линейной регрессии × 10 3 триплетных частотных зависимостей от числа TEF в деформациях WT (ось x) и ΔArg (ось y). Точки, соответствующие кодонам аргинина, декодируемым тРНК Arg ACG , показаны красным.( C ) Трансляционная эффективность разработанных конструкций. Схематическое изображение (нижняя часть панели) и эффективность перевода (верхняя часть панели) конструкций. Эффективность трансляции репортера CER была нормализована к эталонной конструкции RFP и указана в виде диаграммы. Все обозначения конструкций указаны рядом со схематическими изображениями и под соответствующими полосами. Кодоны аргинина, декодируемые тРНК Arg ACG , показаны красным, а кодоны, декодированные другими тРНК, показаны зеленым.Последовательности перечислены в дополнительной таблице S2. Темно-зеленые столбцы соответствуют штамму дикого типа с полным набором генов тРНК Arg ACG , а светло-зеленые столбцы соответствуют штамму ΔArg (обозначение на графике).

Чтобы подтвердить этот вывод, мы трансформировали клетки штамма ΔArg и клетки родительского штамма дикого типа разработанным набором из четырех репортерных конструкций, содержащих три различных кодона аргинина, следующих за стартовым кодоном CER (рисунок, схема ниже, дополнительная таблица S2) .Выход белка CER в обоих штаммах продемонстрировал незначительные различия (рисунок выше). Снижение численности тРНК Arg ACG приводило к небольшому увеличению выхода белка CER, если неродственные кодоны аргинина AGA располагались близко к началу рамки считывания. В то же время кодоны CGA и CGU родственны тРНК Arg ACG , будучи помещенными в начальную область кодирующей последовательности, поддерживали несколько менее эффективную трансляцию репортера; кодон CGC работал почти идентично.

Ранее опубликованный анализ влияния трехкратного снижения экспрессии гена тРНК Thr UGU в дрожжах на трансляцию эндогенных мРНК (25) также не выявил зависимости эффективности трансляции от наличия кодонов ACA в область рампы мРНК при снижении концентрации тРНК. Простейшая интерпретация этих данных противоречит гипотезе о том, что низкий tAI естественной области рампы мРНК влияет на эффективность их трансляции.Однако эти данные не исключают интерпретации, согласно которой более низкий tAI области рампы может быть объяснен причинами, выходящими за рамки эффективности трансляции конкретной мРНК, например это может быть полезно для трансляции других мРНК за счет уменьшения холостого хода рибосом (11,44).

Влияние доступности питательных веществ на трансляцию конкретных репортерных мРНК

Оценка эффективности трансляции с помощью flowseq была выполнена в богатой среде LB, где прогрессирование рибосом вряд ли будет замедлено из-за дефицита аминокислот.Однако в естественных экологических нишах бактерии могут столкнуться с ограниченными ресурсами. Чтобы решить эту проблему, мы вырастили клетки E. coli дикого типа , трансформированные библиотекой репортерных плазмид в плохой среде M9, и повторили эксперимент flowseq и анализ данных (дополнительная таблица S4, рисунок S6A, B). Влияние конкретных кодонов, находящихся в области рампы, на выход белка (дополнительный рисунок S6C) продемонстрировало в целом хорошее совпадение с тем, которое наблюдалось для E. coli , выращенного в богатой среде (рисунок).Однако мы отметили небольшую разницу в относительном влиянии конкретных кодонов на выход белка CER в богатой и бедной среде в зависимости от идентичности кодируемой аминокислоты. Известно, что для синтеза разных аминокислот требуются разное количество молекул АТФ и восстанавливающих эквивалентов (38). Использование «дорогих» аминокислот в N-концевой области белка может снизить его выход (44). Мы предположили, что при выращивании на плохой среде M9 этот эффект может усиливаться.Для каждого репортера в библиотеке мы рассчитали общую стоимость синтеза аминокислот 2–11, кодируемых его рандомизированной частью, используя значения стоимости отдельных аминокислот, взятые из исх. (36) (подробности см. В разделе "Методы"). Для каждого TEF мы рассчитали среднюю стоимость синтеза всех фрагментов в этом TEF, а затем сравнили соотношение этих средних затрат для TEF, полученных путем сортировки клеток, выращенных в минимальной среде M9 или богатой среде LB (рисунок). Наклон линии регрессии этого отношения на число TEF отрицательный, значение P равно 0.018. Это показывает, что хотя в целом влияние затрат на синтез аминокислот невелико, оно больше способствует эффективности трансляции в бедной среде M9, чем в богатой среде LB. Среднее соотношение стоимости для каждого TEF в M9 и LB, рассчитанное отдельно для каждого положения кодона (дополнительный рисунок S6D), показывает, что стоимость аминокислоты в положении +2 является основным фактором этого эффекта. Этот результат согласуется с наблюдением, что свойства кодонов, проксимальных к стартовому кодону, в целом влияют на эффективность трансляции больше, чем более удаленные.

Влияние метаболической стоимости аминокислот на эффективность трансляции в богатой и бедной среде. ( A ) Влияние стоимости метаболизма аминокислот на эффективность трансляции в богатой и бедной среде. Отношение средних метаболических затрат на аминокислоты, кодируемые кодонами 2–11 репортерных конструкций, которые попали в конкретный TEF (ось x) в бедной и богатой средах (M9 / LB). Заштрихованная область показывает 95% доверительные интервалы для линии регрессии.( B ) Эффективность трансляции сконструированных конструкций (ось y) в различных средах (ось x) после 2 дней культивирования для компенсации различных скоростей роста в богатых и бедных средах. Показаны две пары репортерных конструкций. Энергия сворачивания в одной и той же паре (одинаковые цвета графиков) должна быть постоянной. Толстые линии соответствуют репортерам, триплеты 2–11 которых кодируют более дорогой набор аминокислот, а тонкие линии соответствуют репортерам, кодирующим более дешевые аминокислоты.Метаболическая стоимость аминокислот 2–11 репортера (38) показана рядом с графиками. Последовательности перечислены в дополнительной таблице S2. Были использованы следующие среды: LB (LB), LB, разбавленный 1: 4 водой (LB / 4), M9 с глюкозой и дорогими аминокислотами Tyr, His, Ile, Leu (M9 + AA), M9 с глюкозой без аминокислоты (M9), M9 с глицерином без глюкозы (M9 / Gly).

Чтобы оспорить этот вывод, мы разработали две пары репортерных конструкций. В каждой паре метаболические затраты на кодированные аминокислоты были противоположными, в то время как характеристики другие, когда затраты на метаболизм аминокислот, такие как энергия сворачивания мРНК и SD-подобие, оставались равными.Мы также избегали кодонов и кодонов AUG со значительным ингибирующим влиянием на трансляцию для этих пар мРНК (на рисунке линии одного цвета соответствуют мРНК с одинаковой энергией сворачивания, метаболические затраты указаны рядом с графиками, жирные линии соответствуют «дорогим». от фрагментов и тонких линий до «дешевых» фрагментов). Клетки, трансформированные репортерными конструкциями, выращивали либо в богатой среде LB (рисунок, среда, указанная под графиками), либо в среде LB, разбавленной в 4 раза, M9 с аминокислотами и глюкозой, M9 с глюкозой и M9 с глицерином вместо глюкозы.Измерение выхода трансляции (рисунок) показало, что если части, кодирующей белок CER, предшествовал участок дорогих аминокислот, его синтез оказался чувствительным к богатству среды (рисунок, жирные линии снижаются от LB к более бедным средам. ), в то время как эта зависимость отсутствовала или даже обратная в противоположном случае (рисунок, тонкие линии остаются постоянными или увеличиваются от LB к более бедным средам). Вероятное объяснение этого эффекта может заключаться в более быстром очищении сайта связывания рибосомы удлиняющейся рибосомой, если не нужно ждать аа-тРНК, заряженной дорогой аминокислотой, которая, по-видимому, меньше в плохой среде.

Информация для авторов

Илья А Остерман, Сколковский институт науки и технологий, Сколково, Московская область 143025, Россия. Московский государственный университет им. М.В. Ломоносова, Москва 119992, Россия.

Зоя С Червонцева, Сколковский институт науки и технологий, Сколково, Московская область 143025, Россия. Институт проблем передачи информации им. А.А. Харкевича, Москва, 127051, Россия.

Евфратов Сергей А, Московский государственный университет им. М.В. Ломоносова, Москва 119992, Россия.

Сорокина Алена Васильевна, Сколковский институт науки и технологий, Сколково, Московская область 143025, Россия.

Родина Владимира А, Московский государственный университет им. М.В. Ломоносова, Москва 119992, Россия.

Рубцова Мария Павловна, Сколковский институт науки и технологий, Сколково, Московская область 143025, Россия. Московский государственный университет им. М.В. Ломоносова, Москва 119992, Россия.

Екатерина С Комарова, Сколковский институт науки и технологий, Сколково, Московская область 143025, Россия.Московский государственный университет им. М.В. Ломоносова, Москва 119992, Россия.

Тимофей С Зацепин, Сколковский институт науки и технологий, Сколково, Московская область 143025, Россия. Московский государственный университет им. М.В. Ломоносова, Москва 119992, Россия.

Марсель Р Кабилов, Институт химической биологии и фундаментальной медицины СО РАН, 630090 Новосибирск, Россия.

Богданов Алексей А, Московский государственный университет им. М.В. Ломоносова, Москва 119992, Россия.

Михаил С Гельфанд, Сколковский институт науки и технологий, Сколково, Московская область 143025, Россия.Институт проблем передачи информации им. А.А. Харкевича, Москва, 127051, Россия.

Ольга А Донцова, Сколковский институт науки и технологий, Сколково, Московская область 143025, Россия. Московский государственный университет им. М.В. Ломоносова, Москва 119992, Россия. Институт биоорганической химии имени Шемякина-Овчинникова, Москва 117997, Россия.

Петра В Сергиева, Сколковский институт науки и технологий, Сколково, Московская область 143025, Россия. Московский государственный университет им. М.В. Ломоносова, Москва 119992, Россия.

Границы | Многогранный механизм ингибирования амикумацином А бактериальной трансляции

Введение

Распространение устойчивости к антибиотикам среди бактерий - одна из самых актуальных проблем медицины, так как известные и давно применяемые антибиотики со временем теряют свою эффективность. Наиболее перспективными способами решения этой проблемы являются создание аналогов на основе существующих антибиотиков, поиск новых природных веществ с антибактериальной активностью, а также тщательное изучение антибактериальных средств и механизмов устойчивости к ним (Nicolaou, Rigol, 2018; Witzky et al., 2019). Амикумацин A (Ami) - это вещество, которое может стать новым терапевтическим противомикробным средством. Молекулярный механизм действия подробно не известен; однако предварительные исследования показали, что Ami может иметь необычный механизм ингибирования трансляции, а бактериальные клетки могут использовать ранее не описанный механизм устойчивости (Polikanov et al., 2014).

Ami был впервые выделен в начале 1980-х годов из морских грамположительных бактерий Bacillus pumilus (Itoh et al., 1981). Позже было показано, что другие представители рода Bacillus (Pinchuk et al., 2002), грамположительные бактерии рода Norcadia (Sun et al., 2009) и грамотрицательные Xenorhabdus bovienii ( Park et al., 2016) могли производить антибиотик. Недавние исследования выявили кластеры генов, ответственных за синтез Ami, и продемонстрировали особые способы подавления токсичности Ami во время его синтеза клетками штамма-продуцента (Li et al., 2015; Park et al., 2016; Терехов и др., 2018). Ami принадлежит к небольшой группе производных 3,4-дигидроизокумарина под названием AI-77 (Shimojima et al., 1982), структурно сходных с ксенокумацинами, бацилосарцинами и липокумацинами (McInerney et al., 1991; Azumi et al., 2008; Li и др., 2012). Наиболее известными представителями группы амикумацинов являются амикумацин A, B и C, различающиеся по радикалам при атоме C-12 '. Считается, что присутствие амидной группы в этом положении обеспечивает множественные эффекты Ami (Hashimoto et al., 2007; Ли и др., 2012). Действительно, Ami является единственным представителем группы, проявляющей противовоспалительную, гастропротекторную (Itoh et al., 1981), противоопухолевую (Lama et al., 2012; Prokhorova et al., 2016) и сильную антимикробную активность в отношении широкого диапазона микроорганизмов, патогенных для человека и животных (Пинчук и др., 2001, 2002; Ли и др., 2015; Гао и др., 2017; Терехов и др., 2018).

Несмотря на то, что Ami был открыт очень давно, о механизме его действия известно немного. Недавно было показано, что Ami активирует несколько генов, участвующих в различных метаболических путях (Lama et al., 2012), при этом рибосома считается его основной мишенью для проявления антибактериального эффекта. Ami связывается с E-сайтом 30S-субъединицы, контактирующим с консервативными нуклеотидами U788, A794, C795 h34, нуклеотидом G693 h33 и нуклеотидами G1505 и U1506 h55 16S рРНК, а также с остовом мРНК на Области нуклеотидов -1 и -2 без прямого взаимодействия с тРНК E-сайта (Polikanov et al., 2014) (Рисунок 1). Сайт связывания аминов перекрывается с сайтами других хорошо известных антибиотиков, таких как эдеин, касугамицин и пактамицин (Pioletti et al., 2001; Schluenzen et al., 2006; Поликанов и др., 2014). Тем не менее, Ami использует другой способ взаимодействия с молекулами мРНК и 16S рРНК, а именно стабилизацию мРНК в E-сайте вместо его замещения, что подразумевает уникальный способ ингибирования трансляции (Polikanov et al., 2014). Первоначальные исследования Ami показали, что основной механизм действия направлен на транслокацию и в меньшей степени связан с инициацией (Поликанов и др., 2014; Прохорова и др., 2016). Однако подробный механизм подавления Ами еще не раскрыт.

Рисунок 1. Модель расположения Ami в E-сайте рибосомного комплекса. Модель представляет взаимодействие Ami (светло-синий) с 5'-концом мРНК (зеленый) и подразумеваемое взаимодействие 16S рРНК (оранжевый) с аминокислотами EF-G (пурпурный) (желтый), обеспечивая устойчивость к Ami. Консервативные петли EF-G I и II показаны коричневым и синим цветом соответственно. ТРНК P-сайта показана светло-серым цветом (PDB: 4V7D, 4V5F, 4W2F и 4V9O).

Необычный механизм ингибирования трансляции Ami заставил бактериальные клетки использовать новый ранее не описанный механизм устойчивости (Polikanov et al., 2014). Анализ клеток Escherichia coli и Staphylococcus aureus , проявляющих устойчивость к Ami, выявил специфические мутации в генах, кодирующих 16S рРНК, KsgA-метилтрансферазу и фактор трансляции EF-G (Lama et al., 2012; Polikanov et al., 2014) . Определенные мутации в генах 16S рРНК и KsgA метилтрансферазы приводят к устойчивости к пактамицину (Mankin, 1997) и касугамицину (Helser et al., 1972; Schuwirth et al., 2006). В обоих случаях механизм устойчивости объяснялся изменением контактов между антибиотиком и 30S субъединицей.Вероятно, замены C795U или A794G в 16S рРНК, а также делеция 14 нуклеотидов (Δ424–437) в гене ksgA или укорочение KsgA-метилтрансферазы (L260Stp) по тому же механизму приводят к устойчивости к Ami. Однако устойчивость к антибиотикам из-за аминокислотных замен в домене IV EF-G ранее не описывалась. Все найденные изменения G542V, G581A или ins544V в EF-G из E. coli , а также G542V или G543S в EF-G из S. aureus ( E.coli ) расположены в той части фактора, которая взаимодействует с комплексом тРНК-мРНК на рибосоме (Gao et al., 2009), находясь в то же время более чем на 16 Å от сайта связывания Ami, что позволяет предположить наличие довольно косвенный механизм устойчивости (Поликанов и др., 2014) (рисунок 1).

В данной работе мы проводим систематическое исследование влияния Ami на основные этапы синтеза полипептидов и анализируем особенности транслокации, катализируемой вариантами EF-G, обеспечивающими устойчивость к Ami.Полученные результаты позволяют детально раскрыть механизм ингибирования трансляции бактерий Ami.

Материалы и методы

Материалы

Субъединицы 30S и 50S, рибосомы 70S, факторы инициации (IF1, IF2 и IF3), fMet-tRNA fMet (Milon et al., 2007), Phe-tRNA Phe , [ 14 C] Phe -тРНК Phe и [ 14 C] Val-тРНК Val , EF-Tu (Wieden et al., 2002), дрожжевая тРНК Phe (Prf16 / 17), тРНК fMet (Prf20) из E.coli (Wintermeyer et al., 1980), BPY-Met-тРНК fMet (Holtkamp et al., 2014) и мРНК, содержащая последовательность 5'-ACU ⋅ AUG ⋅ UUU-3 'и кодирующая, соответственно, Met -Phe- (Виноградова и др., 2020) или содержащие 5'-ACU AUG ⋅ GUU ⋅ UUU-3 'и кодирующий Met-Val-Phe- получали в соответствии с методами, описанными ранее. Ami был очищен из штамма B. pumilus INA 01087, как описано ранее (Polikanov et al., 2014). мРНК с инициирующим кодоном UUC была получена путем сайт-направленного мутагенеза с использованием праймеров 5'-GGTATACATACTTTCTTTACGATTACTACG-3 'и 5'-CGTAGTAATCGTAAAGATAAAGT-3' на основе мРНК 5'-ACU ⋅ AUG ⋅ UUU-3 ', очищенной, как описано ранее. (Виноградова и др., 2020).

Ген, кодирующий интактную форму (wt) или мутантные варианты (G542V, G581A, ins544V) EF-G из E. coli , был клонирован в вектор pCA24AN под IPTG-индуцибельным промотором Т5 (Поликанов и др., 2014). Интактные или мутантные формы EF-G были экспрессированы в штамме E. coli BL21 (DE3) и очищены с помощью аффинной хроматографии в соответствии с ранее опубликованной процедурой (Cunha et al., 2013). Все белки содержат 6 × His-метку на N -конце.

Все эксперименты проводились в буфере TAKMx, содержащем 50 мМ Трис-HCl pH 7,5, 70 мМ NH 4 Cl, 30 мМ KCl и X мМ MgCl 2 (7 мМ ≤ X ≤ 21 мМ).

Образование комплексов

30S инициирующий комплекс (IC) был сформирован путем инкубации 1 мкМ реактивированных субъединиц 30S с 0,5 мкМ BPY-Met-тРНК fMet , 2 мкМ IF1, 1 мкМ IF2, 1,5 мкМ IF3, 0,5 мМ GTP и соответствующей мРНК в буфер ТАКМ 7 в течение 30 мин при 37 ° C. Перед формированием 30S IC субъединицы 30S реактивировали инкубацией в буфере TAKM 20 в течение 30 минут при 37 ° C.

70S IC был сформирован путем инкубации 2 мкМ 70S рибосом, 4 мкМ каждого из факторов инициации (IF1, IF2 и IF3), 12 мкМ мРНК, кодирующей Met-Phe-…, 4 мкМ тРНК инициатора, 1 мМ GTP и 1 мкМ. мМ DTT в буфере TAKM 7 в течение 1 ч при 37 ° C. При необходимости ИК очищали гель-фильтрационной хроматографией на колонке BioSuite 450 HR SEC, 7,8 × 300 мм (Waters, США) в буфере TAKM 7 .

Тройной комплекс EF-Tu⋅GTP⋅Phe-тРНК Phe был образован инкубацией 24 мкМ EF-Tu, 1 мМ GTP, 1 мМ DTT, 0.5 мг / мл пируваткиназы (Roche Diagnostics, Швейцария), 3 мМ фосфоенолпирувата в буфере TAKM 7 в течение 15 мин при 37 ° C, затем добавляли 12 мкМ Phe-тРНК Phe и смесь инкубировали еще 5 мин при 37 ° С. Phe-тРНК Phe очищали с помощью ВЭЖХ и хранили при -80 ° C, тогда как Phe-тРНК Phe (Prf16 / 17) получали непосредственно перед образованием тройного комплекса. Для этого 8 мкМ тРНК Phe (Prf16 / 17) инкубировали с 0,2 мМ Phe, 3 мМ АТФ, 6 мкМ 2-меркаптоэтанолом, 40 нМ фенилаланин-тРНК синтетазой, 40 нМ тРНК нуклеотидилтрансферазой в буфере TAKM 7 в течение 30 дней. мин при 37 ° C.

Претранслокационные комплексы были сформированы путем смешивания инициирующих 70S и тройных комплексов с последующей инкубацией в течение 1 мин при 25 ° C. Для очистки концентрацию ионов Mg 2+ увеличивали до 21 мМ, и смесь предтранслокационных комплексов наслаивали на 500 мкл 1,1 М сахарозной подушки (приготовленной в буфере TAKM 21 ) с последующим центрифугированием в SW55. ротор (Beckman Coulter, США) при 55000 об / мин в течение 3 ч при 4 ° С. Образовавшийся осадок растворяли в буфере ТАКМ 21 , шоковой заморозки в жидкости N 2 и хранили при -80 ° C.

Микромасштабный термофорез

Для определения сродства мРНК к 30S IC использовали метод микромасштабного термофореза (MST) (Виноградова и др., 2020). 30S IC был сформирован с BPY-Met-тРНК fMet (инициаторная тРНК, меченная Bodipy FL по метиониновому фрагменту) и возрастающими концентрациями соответствующей мРНК в буфере TAKM 7 в течение 30 минут при 37 ° C в присутствии 60 мкМ амикумацина. A, 30 мкМ эдеина, 60 мкМ касугамицина или без антибиотика. Обнаружение изменений флуоресценции проводили на приборе Monolith NT.115 (NanoTemper Technologies GmbH, Германия), используя стандартные капилляры (каталожный MO-K022, Nanotemper Technologies, Германия). Применялся зеленый фильтр, мощность монохроматического светодиода составляла 30%, а интенсивность ИК-лазера составляла 40%. Каждый эксперимент проводился в трех повторностях.

Эксперименты по быстрой кинетике

Быструю кинетику измеряли с использованием аппарата с остановленным потоком SX-20 (Applied Photophysics, Leatherhead, United Kingdom). Флуоресценцию профлавина возбуждали при 460 нм, флуоресценцию Bodipy FL возбуждали при 470 нм и измеряли после прохождения через отсекающий фильтр KV490 нм (Schott, Майнц, Германия) в обоих случаях.Эксперименты по рассеянию света проводили при 430 нм с последующим детектированием под углом 90 ° без отсекающего фильтра. Эксперименты проводили в буфере TAKM 7 с 1 мМ GTP и 1 мМ DTT при 20 ° C (связывание аминоацил-тРНК с сайтом A) (Wieden et al., 2002; Pan et al., 2008), 25 ° C (образование 70S IC) (Виноградова и др., 2020) или 37 ° C (транслокация) (Holtkamp et al., 2014). При необходимости добавляли 30 мкМ амикумацина А, 30 мкМ эдеина, 60 мкМ касугамицина, 30 мкМ тетрациклина, 150 мкМ кирромицина или 200 мкМ виомицина.Образцы быстро перемешивали в равных объемах. Временные ходы, изображенные на рисунках, были получены путем усреднения 5–7 отдельных переходных процессов. Данные оценивались путем подгонки к одноэкспоненциальной функции с характеристической постоянной времени ( k приложение ), амплитудой ( A ) и конечной амплитудой сигнала ( F 0 ) в соответствии с уравнением . F = F 0 + A × exp (- k приложение × t ), где F - флуоресценция в момент времени t .При необходимости использовались два экспоненциальных члена с двумя характеристическими постоянными времени ( k приложение 1 , k приложение 2 ), амплитуда ( A 1 , A 2 ), согласно уравнению F = F 0 + A 1 × exp (- k приложение 1 × t 2) + A 2) × exp (- k приложение 2 × t ).Для анализа концентрационной зависимости констант кажущейся скорости транслокации от концентрации фактора элонгации EF-G использовали гиперболическую функцию. Расчеты выполнены в программе Prism 6.02 (GraphPad Software, США). Стандартные отклонения были рассчитаны с использованием того же программного обеспечения.

Для изучения аккомодации инициатора BPY-Met-тРНК fMet и слияния субъединицы 50S при образовании 70S IC 0,1 мкМ 30S IC, запрограммированные с помощью соответствующей мРНК, быстро смешивали с 0.3 мкМ субъединицы 50S (приведены конечные концентрации после смешивания).

Для изучения связывания аминоацил-тРНК с сайтом А рибосомы IC, содержащую fMet-тРНК fMet (Prf20) (инициаторную тРНК, меченную профлавином в положении 20 в локтевой области тРНК), быстро смешивали с тройным комплексом. fMet-тРНК fMet (Prf20) получали непосредственно перед образованием IC, как описано ранее (Milon et al., 2007).

Для изучения кинетики транслокации до установившегося состояния мы использовали комплексы до транслокации, содержащие деацилированную тРНК fMet в P-сайте и флуоресцентно меченную fMet-Phe-тРНК Phe в A-сайте.Чтобы охарактеризовать движение центральной части тРНК при транслокации, мы использовали профлавин, присоединенный к дигидроуридину в положении 16 и / или 17, расположенном в локтевой области fMet-Phe-tRNA Phe [fMet-Phe-tRNA Phe (Prf16 / 17)] (Savelsbergh et al., 2000). Чтобы контролировать смещение акцепторного конца тРНК от сайта A к сайту P, мы использовали Met-Phe-тРНК Phe , меченную Bodipy FL по метиониновому фрагменту (BPY-Met-Phe-тРНК Phe ) (Holtkamp et al. ., 2014).Претранслокационные комплексы быстро смешивали с увеличивающейся концентрацией дикого или мутантного вариантов EF-G в присутствии 1 мМ GTP.

Образование пептидной связи

Для анализа образования дипептида fMet-Phe 0,5 мкМ 70S IC, содержащего fMet-тРНК fMet на сайте P, смешивали с равным объемом 1 мкМ тройного комплекса EF-Tu⋅GTP⋅ [ 14 C] Phe-tRNA. Phe и инкубировали в буфере TAKM 7 в течение 1 мин при 25 ° C. Затем образцы закаливали 1/10 объема 5 М КОН и гидролизовали в течение 30 мин при 37 ° C.Образцы нейтрализовали 1/10 объема ледяной уксусной кислоты и анализировали обращенно-фазовой ВЭЖХ. Процент синтезированного дипептида определяли путем включения радиоактивной метки, как описано ранее (Rodnina and Wintermeyer, 1995). Эксперименты проводили в четырех повторностях.

Для анализа образования трипептида fMet-Val-Phe были сформированы и очищены предтранслокационные комплексы, содержащие деацилированную тРНК fMet в P-сайте и fMet- [ 14 C] Val-тРНК Val в A-сайте. центрифугирование через подушку из сахарозы, как описано выше.Затем смесь тройного комплекса EF-Tu⋅GTP⋅Phe-тРНК Phe (1,6 мкМ) с EF-G wt или EF-G G542V (5 мкМ) добавляли к комплексам перед транслокацией (0,4 мкМ) в режиме гашения. расходомер KintTek RQF-3 (KinTek Corporation, США). Эксперименты проводили в буфере ТАКМ 7 с добавлением 1 мМ DTT и 1 мМ GTP при 20 ° C. Реакцию останавливали в определенные моменты времени добавлением 0,8 М КОН, и последующие процедуры измерения синтезированного трипептида fMet- [ 14 C] Val-Phe выполняли, как описано выше для анализа образования дипептида.Константы скорости реакции рассчитывали с использованием одного или двух экспоненциальных уравнений.

Для анализа образования дипептидов ИК были сформированы в присутствии 30 мкМ амикумацина А или 2 мкМ мадумицина II; Для анализа образования трипептидов очищенные предтранслокационные комплексы предварительно инкубировали с 30 мкМ амикумацином А в течение 10 мин при 25 ° С, а затем смешивали с другими компонентами реакции.

Множественная передача оборота

Реакцию проводили согласно ранее опубликованному методу (Savelsbergh et al., 2000). Для экспериментов использовали 0,2 мкМ комплексы предварительной транслокации, содержащие деацилированную тРНК fMet в сайте P и fMet- [ 14 C] Val-тРНК Val или fMet- [ 14 C] Phe-тРНК Phe в A сайта, очищали гель-фильтрационной хроматографией и добавляли 3 нМ мас. или мутантную форму EF-G. Реакцию проводили в буфере ТАКМ 14 при 25 ° C. При необходимости добавляли 30 мкМ амикумацин А. Для образования fMet- [ 14 C] Val-Pmn или fMet- [ 14 C] Phe-Pmn посттранслокационные комплексы смешивали с 1 мМ Pmn в течение 10 с при 37 ° C.Реакцию гасили 1,5 М ацетатом натрия, насыщенным MgSO 4 . fMet- [ 14 C] Val-Pmn или fMet- [ 14 C] Phe-Pmn экстрагировали этилацетатом и количественно определяли подсчетом радиоактивности.

Стабильность связывания пептидил-тРНК в сайте A

Эксперименты и расчеты проводились по ранее опубликованной методике (Konevega et al., 2004), а именно: комплексы предтранслокации (0,25 мкМ), содержащие деацилированную тРНК , fMet по сайту P и fMet- [ 14 C] Val- тРНК Val в сайте A очищали центрифугированием через подушку из сахарозы.Чтобы вызвать диссоциацию fMet- [ 14 C] Val-тРНК Val из сайта A, концентрацию Mg 2+ в буфере TAKM доводили до 7, 8,5, 10, 15 или 20 мМ, и количество пепт-тРНК, связавшейся с сайтом A в разное время инкубации при 37 ° C (с 30 мкМ амикумацина A или без него), определяли нитроцеллюлозной фильтрацией. Константы скорости элементов диссоциации и ассоциации, k от и k на , были рассчитаны из динамики диссоциации путем численного интегрирования (Konevega et al., 2004). Использовалась следующая кинетическая модель: A ⇔ B + C и B ⇒ D, где A обозначает рибосомы с пепт-тРНК, связанной с сайтом A; B, несвязанная пепт-тРНК; C - рибосомы с незанятым сайтом A; D, гидролизованная пепт-тРНК. k hydr - константа скорости гидролиза пепт-тРНК в свободном растворе. Константа равновесной диссоциации была рассчитана как K D = k off / k on . Свободную энергию связывания (ΔG 0 ) рассчитывали из значений K d в соответствии с уравнением ΔG 0 = -RTln ( K d ).

nanoDSF

Для определения конформационной стабильности и идентичности интактных и мутантных форм EF-G nanoDSF использовали метод Prometheus NT.48 (NanoTemper Technologies GmbH, Германия). Точку плавления ( T m , ° C), температуру, при которой разворачивалась половина белка, определяли измерениями интенсивности флуоресценции ароматических аминокислотных остатков при соотношении 330, 350 и 350/330 нм. Белки разводили до конечной концентрации 5 мкМ в буфере TAKM 7 в присутствии 1 мМ GTP.Для реакции отбирали 10 мкл образца с использованием стандартных капилляров (каталожный PR-C002, Nanotemper Technologies, Германия). Эксперимент по плавлению проводился с шагом 0,1 ° С / мин в интервале температур 15–95 ° С, интенсивность лазера составляла 30%.

Результаты

Амикумацин А замедляет инициирование

Синтез полипептида начинается с этапа инициации, который направлен на правильное позиционирование инициатора fMet-тРНК fMet над стартовым кодоном мРНК в Р-сайте рибосомы.У бактерий этот процесс управляется тремя факторами инициации белка. IF1 связывается с сайтом A небольшой 30S рибосомной субъединицы и предотвращает проникновение аминоацил-тРНК. IF2 распознает N -формилметиониновый фрагмент инициатора fMet-тРНК fMet и облегчает связывание этой тРНК. IF3 принимает участие в выборе тРНК инициатора, контролирует правильное взаимодействие кодон-антикодон и присоединение 50S-субъединицы, обеспечивая точность образования IC. Инициация включает три основные фазы: 1) сборка факторов инициации, мРНК и инициатора fMet-тРНК fMet на субъединице 30S в пре-IC комплекс (30S пре-IC), 2) преобразование 30S пре-IC в стабильная 30S IC после распознавания стартового кодона мРНК fMet-tRNA fMet , 3) присоединение 50S субъединицы к 30S IC, что приводит к образованию 70S IC (Gualerzi and Pon, 2015).Поскольку амикумацин A (Ami) связывается с мРНК вблизи области стартового кодона (Polikanov et al., 2014), он может влиять на связывание мРНК с 30S-субъединицей и распознавание кодон-антикодон в P-сайте. Кроме того, можно было ожидать ухудшения присоединения 50S-субъединицы к 30S IC из-за контролирующей функции IF3. Чтобы проверить эту гипотезу, мы сравнили сродство мРНК к 30S IC, способность 30S IC образовывать 70S IC и аккомодировать тРНК P-сайта в присутствии Ami и в системе без антибиотиков с учетом участия IF3.

Инициирование в полной системе

Мы использовали MST для мониторинга образования 30S IC по изменению флуоресценции BPY-Met-тРНК fMet (Виноградова и др., 2020) при возрастающих концентрациях модельной мРНК (Калоджеро и др., 1988) (Рисунок 2А). Присутствие Ami привело почти к снижению аффинности мРНК [ K d (без Ami) = 18 ± 9 нМ; K d (с Ami) = 169 ± 39 нМ], тогда как амплитуда была уменьшена только на 20% (рисунки 2A, B), предполагая, что Ami сохранила способность IC образовываться, хотя и с более низким сродством к мРНК.Было показано, что образование неканонических 30S IC либо с классическим стартовым кодоном мРНК AUG, замененным на UUC, либо с инициатором fMet-тРНК fMet , замененным на элонгатор Phe-тРНК Phe , нарушается (рис. 2A) (Виноградова и др., 2020). Однако добавление Ami стимулировало образование неканонических 30S IC. Значения связывания полученных комплексов находились в субмикромолярном диапазоне [ K d (UUC + Ami) = 584 ± 165 нМ; K d (AUG / Phe + Ami) = 940 ± 166 нМ] (Рисунки 2A, B).Степень образования 30S IC, судя по амплитуде сигнала на кривых титрования, была заметно ниже, чем для комплексов со стартовым кодоном AUG и инициатором fMet-тРНК fMet , но намного выше по сравнению с отсутствием Ami. Таким образом, Ami, по-видимому, снижает сродство оптимальных мРНК, но значительно усиливает ошибочные 30S-комплексы, подчеркивая стабилизирующий эффект Ami для неканонической инициации с неправильным стартовым кодоном или элонгаторной тРНК. Для дополнительной проверки наших результатов мы использовали два ингибитора инициации, которые имеют общий сайт связывания с Ami, эдеин (Ede) и касугамицин (Ksg).Ede ингибирует связывание тРНК с сайтом P, предотвращая взаимодействие кодон-антикодон (Dinos et al., 2004). В соответствии с предыдущими результатами, анализ MST показал, что образование 30S IC было значительно нарушено Ede. Только 52% комплексов смогли образоваться, о чем свидетельствует уменьшение амплитуды кривой титрования. Кроме того, аффинность связывания мРНК с 30S IC была снижена более чем в 30 раз [ K d (Ede) = 568 ± 108 нМ], подразумевая, что Ede не только нарушает спаривание оснований кодон-антикодон, но также препятствует связыванию мРНК.Ksg искажает путь мРНК в рибосоме, что приводит к гипотезе предотвращения распознавания стартового кодона инициаторной тРНК (Schluenzen et al., 2006; Schuwirth et al., 2006). Однако открытие контекстно-специфического действия Ksg предполагает, что этот антибиотик по-разному подавляет инициацию трансляции мРНК в зависимости от последовательности кодонов E-сайта и P-сайта (Chin et al., 1993; Vázquez-Laslop and Mankin, 2018). В наших экспериментах присутствие Ksg не влияло на формирование 30S IC.Амплитуда кривой титрования и аффинность [ K d (Ksg) = 59 ± 10 нМ] были сравнимы с таковыми, полученными для канонической 30S IC (рисунки 2A, B).

Рисунок 2. Влияние Ami на инициацию в полной системе. (A) Титрование образования 30S IC с помощью мРНК, содержащей стартовый кодон AUG (обозначенный как AUG, в присутствии Ami, AUG + Ami; Ede, эдеин; Ksg, касугамицин), стартовый кодон UUC (обозначенный как UUC, в наличие Ami - UUC + Ami), старт-кодон AUG с участием элонгатора BPY-Phe-tRNA Phe (обозначается как AUG / Phe, в присутствии Ami - AUG / Phe + Ami). (B) Константы диссоциации ( K d ), рассчитанные из (A) . Значение K d для мРНК с AUG в отсутствие Ami очень низкое и практически не видно на графике; значения K d для мРНК со стартовым кодоном UUC или кодоном AUG с участием Phe-тРНК Phe в отсутствие Ami не показаны, поскольку они не образуют инициирующий комплекс. (C) Ассоциация субъединицы 50S (0.3 мкМ) с помощью 30S IC (0,1 мкМ), контролируемого по светорассеянию. Временные кривые помечены в соответствии с стартовым кодоном мРНК и присутствием Ami, Ede или Ksg. (D) Ассоциация субъединицы 50S (0,3 мкМ) с 30S IC (0,1 мкМ), отслеживаемая по флуоресцентному сигналу от репортера BPY инициатора BPY-Met-тРНК fMet , маркировка как в (C) .

Чтобы проверить, может ли Ami-содержащая 30S IC образовывать 70S IC, мы контролировали присоединение 50S-субъединицы к 30S IC методом светорассеяния в аппарате с остановленным потоком.Увеличение сигнала светорассеяния было аппроксимировано двухэкспоненциальной кривой, предполагающей, что реакция имела две фазы, где первая фаза имела более 70% амплитудного сигнала с кажущейся константой скорости k app = 6,9 ± 0,1 с –1 (рис. 2C), в соответствии с предыдущими наблюдениями для мРНК со стартовым кодоном AUG (Milon et al., 2008; Goyal et al., 2015). В присутствии Ede не было обнаружено образования 70S IC, что свидетельствует о сильном влиянии этого антибиотика на образование 30S IC.Хотя Ksg не влиял на формирование 30S IC, он проявлял свое действие на следующем этапе, приводя к меньшему количеству ассоциированных субъединиц, что выражалось в двукратном уменьшении амплитуды сигнала. Ami выявил другой режим подавления: общая амплитуда сигнала осталась неизменной, тогда как первая фаза была в два раза меньше, а скорость снижения - в 30 раз ( k app = 0,246 ± 0,008 с –1 ) ( Рисунок 2C). Кроме того, мы проследили, как Ami влияет на аккомодацию флуоресцентно меченого инициатора BPY-Met-tRNA fMet в сайте P при присоединении субъединицы 50S, что является поздней стадией образования 70S IC (Виноградова и др., 2020). Уменьшение сигнала флуоресценции соответствовало однофазной реакции (рис. 2D). Подобно стадии ассоциации субъединиц, Ami сильно задерживает аккомодацию тРНК. Присутствие антибиотика уменьшало амплитуду сигнала до 57% при 15-кратном снижении скорости [ k app (без Ami) = 2,26 ± 0,02 с –1 ; k приложение (Ami) = 0,148 ± 0,002 с –1 ]. Как и ожидалось из предыдущих экспериментов по инициированию, в присутствии Ede аккомодация тРНК не была обнаружена, тогда как Ksg продемонстрировал лишь умеренный ингибирующий эффект с двукратным уменьшением амплитуды сигнала без значительного влияния на скорость реакции [ k приложение (кг) = 1.70 ± 0,02 с –1 ]. ICs, содержащие мРНК со стартовым кодоном UUC, независимо от присутствия Ami, демонстрировали очень низкую амплитуду изменения флуоресценции (Фигуры 2C, D). Значительное снижение скорости реакции как при присоединении 50S субъединицы, так и при аккомодации тРНК указывает на то, что ошибочные 70S IC образуются редко.

Итак, три ингибитора инициации, имеющие общие перекрывающиеся сайты связывания на рибосоме, действуют по-разному. Ede значительно ухудшает образование 30S IC, скорее всего, за счет смещения мРНК, препятствующей взаимодействию кодон-антикодон в P-сайте.Ksg, напротив, не влияет на инициирование 30S и лишь незначительно нарушает формирование 70S IC. Поскольку Ksg является контекстно-специфическим антибиотиком, его мягкий ингибирующий эффект может быть связан с последовательностью мРНК, использованной в исследовании. В присутствии Ami 30S IC, запрограммированная мРНК с классическим стартовым кодоном AUG, образует 70S IC, хотя и с меньшей скоростью. В то же время наши данные показывают, что Ami усиливает образование ошибочных 30S IC со стартовым кодоном UUC; однако эти комплексы не способны строить 70S IC, вероятно, из-за того, что IF3 кинетически контролирует переход к элонгации (Milon et al., 2008).

Инициирование в системе без IF3

Поскольку IF3 играет особенно важную роль в точности выбора инициаторной тРНК fMet и правильного стартового кодона (Milon and Rodnina, 2012), мы решили изучить участие IF3 в механизме Ami-зависимого ингибирования инициации трансляции. . Мы собрали 30S IC в отсутствие IF3 и исследовали сродство мРНК с разными стартовыми кодонами к таким комплексам. Хотя сродство мРНК к 30S IC без IF3 было очень низким [ K d (AUG) = 1,282 ± 58 нМ, K d (UUC) = 1,271 ± 210 нМ], амплитуды кривых титрования были довольно большими, что указывает на образование комплексов (Фигуры 3A, B).Добавление антибиотика привело к значительному увеличению аффинности мРНК [ K d (AUG + Ami) = 77 ± 18 нМ, K d (UUC + Ami) = 587 ± 42 нМ], в результате чего значения сопоставимы со значениями, полученными для 30S IC, сформированного со всеми компонентами инициации трансляции. Таким образом, Ami увеличивает сродство мРНК к 30S комплексам, лишенным IF3, независимо от инициирующего кодона в P-сайте.

Рисунок 3. Влияние Ami на инициацию в системе без IF3. (A) Титрование образования 30S IC в отсутствие IF3 с мРНК, содержащей стартовый кодон AUG или UUC. (B) Константы диссоциации ( K d ), рассчитанные из (A) . (C) Связь субъединицы 50S (0,3 мкМ) с 30S IC в отсутствие IF3 (0,1 мкМ) контролировали по светорассеянию. (D) Ассоциация субъединицы 50S (0,3 мкМ) с 30S IC в отсутствие IF3 (0,1 мкМ) отслеживается по флуоресцентному сигналу от репортера BPY инициатора BPY-Met-тРНК fMet .

Мы также проанализировали способность 30S IC без IF3 переходить на 70S IC. Как и ожидалось, отсутствие фактора увеличивает скорость реакции присоединения 50S субъединицы независимо от инициирующего кодона (Figure 3C) (Milon et al., 2008). Скорости реакции образования IC с мРНК со стартовыми кодонами AUG или UUC были практически одинаковыми [ k app (AUG) = 25,6 ± 0,3 с –1 ; k приложение (UUC) = 22.9 ± 0,8 с –1 ] с 30% падением амплитуды сигнала для кодона UUC в P-сайте. Присутствие антибиотика не оказало существенного влияния на скорость или амплитуду реакции [ k приложение (AUG + Ami) = 24,7 ± 0,7 с –1 ; k приложение (UUC + Ami) = 22,0 ± 0,7 с –1 ]. Таким образом, механизм ингибирования Ami во время образования 70S IC, по-видимому, зависит от IF3. 30-кратное снижение скорости, вызванное Ami (рис. 2C), отменяется в отсутствие IF3 (рис. 3C).Независимо от кодона в сайте P и присутствия Ami скорость аккомодации тРНК в 30S IC, образованной без IF3, была практически одинаковой [ k app (AUG) = 3,97 ± 0,02 с –1 ; k приложение (UUC) = 3,68 ± 0,04 с –1 ; k приложение (AUG + Ami) = 3,43 ± 0,02 с –1 ; k приложение (UUC + Ami) = 3,63 ± 0,02 с –1 ].Как и в случае присоединения субъединиц, во время комплекса аккомодации тРНК со стартовым кодоном UUC наблюдается более низкая амплитуда сигнала, которая может быть восстановлена ​​почти до максимального значения (случай AUG) добавлением Ami (рисунок 3D). Таким образом, отсутствие IF3 позволяет формировать продуктивные 70S IC, содержащие инициаторную тРНК даже для ошибочных инициирующих кодонов. В этом контексте Ami увеличивал степень комплексов 70S, ошибочно формирующих стартовый кодон UUC.

Наши результаты показывают, что Ami оказывает бинарное негативное влияние на инициацию: он подавляет формирование канонических ИС и поддерживает появление ошибочных ИС.Ami снижает силу связывания правильной мРНК с 30S IC в 10 раз. Кроме того, он значительно снижает (в 30 раз) скорость образования 70S IC, тем самым значительно подавляя каноническую инициацию. В то же время Ami способствует образованию неправильных 30S IC из-за увеличения аффинности связывания мРНК с неправильным стартовым кодоном. Хотя ошибочные комплексы неспособны продвигаться по пути инициации трансляции из-за контролирующего действия IF3, образование таких комплексов требует клеточных ресурсов, которые в противном случае могли бы использоваться для канонической инициации.Анализ системы, в которой отсутствует IF3, поддерживает модель, в которой механизм ингибирования инициации трансляции зависит от IF3. Отсутствие IF3 резко снижает аффинность связывания мРНК, однако полученные комплексы быстро и эффективно превращаются в 70S IC. Ошибочные комплексы со стартовым кодоном UUC приводят к умеренному уменьшению количества образовавшихся 70S IC, которые могут быть легко восстановлены добавлением Ami, скорее всего, из-за увеличения аффинности мРНК. Таким образом, Ami увеличивает количество неправильных 30S IC, преобразованных в 70S IC, что становится возможным в отсутствие IF3.Наши результаты подчеркивают контролирующую функцию IF3, поскольку полная система инициации трансляции не позволяет формировать неправильные 70S IC независимо от присутствия Ami.

Амикумацин А не мешает декодированию и образованию пептидных связей

70S IC, образующийся при инициации трансляции, входит в цикл элонгации, который состоит из этапов декодирования, образования пептидной связи и транслокации (обзор в Родниной, 2018). Декодирование подразумевает распознавание кодона мРНК в сайте A соответствующей аминоацил-тРНК и его аккомодацию на рибосоме.Этап завершается правильным позиционированием акцепторного конца аминоацил-тРНК в пептидилтрансферазном центре рибосомы, что приводит к мгновенному образованию пептидной связи между P-сайтом fMet и аминоацильной группой A-сайта. Полученный в результате комплекс предварительной транслокации содержит деацилированную тРНК в Р-сайте и пептидил-тРНК в А-сайте рибосомы. Здесь размещение Phe-тРНК Phe в сайте A 70S IC отслеживали по изменению флуоресценции профлавина флуоресцентной репортерной группы, присоединенного к дигидроуридину в положении 20, расположенном в локтевой области тРНК инициатора [fMet-tRNA fMet (Prf20)] (Рисунок 4A).Изменение флуоресценции отражает изменение микросреды Prf20 при приближении Phe-тРНК Phe в процессе его аккомодации (Pan et al., 2008). Присутствие Ami не повлияло ни на амплитуду, ни на скорость реакции [ k app (без Ami) = 4,96 ± 0,05 с –1 ; k приложение (Ami) = 4,31 ± 0,06 с –1 ]. Напротив, при применении хорошо известных ингибиторов реакций A-участка практически не наблюдалось изменения сигнала флуоресценции (рис. 4A).Тетрациклин связывается с малой рибосомной субъединицей и стерически нарушает распознавание кодона мРНК антикодоном тРНК A-сайта (Nguyen et al., 2014). Поскольку тетрациклин приводит к резкому снижению скорости связывания тРНК с А-сайтом (Семенков Ю.П. и др., 1982), мы не можем увидеть аккомодацию тРНК А-сайта во временном диапазоне эксперимента (рис. 4А). Кирромицин не препятствует эффективному связыванию аминоацил-тРНК с рибосомой, но подавляет ее аккомодацию в сайте A (Rodnina et al., 1995). Таким образом, присутствие антибиотиков, которые ингибируют связывание или аккомодацию аминоацил-тРНК, не показывает изменения флуоресценции, специфичного для аккомодации тРНК в сайте A рядом с меченной Prf инициаторной тРНК.

Рисунок 4. Влияние Ami на связывание аминоацил-тРНК и стабильность связывания пептидил-тРНК с сайтом А рибосомы. (A) Предварительно установившаяся кинетика взаимодействия тройного комплекса EF-TuheGTP⋅Phe-тРНК Phe (2 мкМ) с IC 70S (50 нМ), содержащим fMet-тРНК fMet (Prf20 ) на участке P без добавления антибиотика (без антибиотика) в присутствии амикумацина A (Ami), тетрациклина (Tet) и кирромицина (Kirr).Зависимость значений k от (B) и k от (C) значений от концентрации ионов Mg 2+ , полученных для претранслокационного комплекса, содержащего деацилированную тРНК fMet на сайте P и fMet- [ 14 C] Val-тРНК Val на сайте A. (D) Значения K d , рассчитанные от (B) до (C) .

Правильная аккомодация аминоацил-тРНК в сайте A приводит к немедленному переносу пептидильного остатка с тРНК P-сайта на тРНК A-сайта, что приводит к образованию дипептида fMet-Phe, присоединенного к тРНК A-сайта.Эффективность реакции можно контролировать путем оценки количества образовавшегося радиоактивно меченного дипептида fMet- [ 14 C] Phe по сравнению со свободной аминокислотой [ 14 C] Phe. Ами-содержащие рибосомные комплексы были столь же эффективны в реакции образования пептидной связи, как и интактные комплексы с количеством образовавшегося дипептида fMet- [ 14 C] Phe, равным 72 ± 7% и 73 ± 8% соответственно. Добавление специфического ингибитора образования пептидной связи мадумицина II (Osterman et al., 2017) серьезно нарушили образование fMet- [ 14 C] Phe, что привело к 33 ± 7%. Таким образом, ни доставка Phe-тРНК Phe в тройном комплексе EF-Tu⋅GTP⋅Phe-тРНК Phe и последующая аккомодация Phe-тРНК Phe , ни образование связи пептида fMet-Phe не были затронуты добавлением Ами.

Поскольку стабильность связывания пептидил-тРНК может влиять на следующую стадию элонгации, транслокацию, мы проанализировали зависимость констант скорости ( k от и k off ) и константы диссоциации ( K d ) связывания пептидил-тРНК в сайте A на концентрации ионов Mg 2+ (Konevega et al., 2004) (Рисунки 4B – D). При физиологической концентрации Mg 2+ (7 мМ) присутствие антибиотика не изменяло k от и k на значениях и оказывало лишь умеренное влияние на сродство пептидила. -тРНК к сайту A [ K d (без Ami) = 688 ± 88 нМ; K d (Ami) = 461 ± 81 нМ]. При повышенной концентрации Mg 2+ (до 20 мМ) скорость диссоциации пептидил-тРНК снижалась в три раза, скорость ассоциации снижалась в 17 раз, а разница в аффинности увеличивалась в пять раз.Результат показывает, что Ami снижает количество ионов Mg 2+ , необходимых для диссоциации и ассоциации, а также для стабилизации пептидил-тРНК в A-сайте. Тем не менее Ami не изменяет стабильности связывания пептидил-тРНК в сайте A в физиологических условиях и не влияет на свободную энергию (ΔG 0 ) связывания, рассчитанную непосредственно из значений K d в соответствии с уравнением ΔG 0 = -RTln ( K d ) [ΔG 0 (без Ami) = −8.74 ± 0,08 ккал / моль; ΔG 0 (Ami) = -8,98 ± 0,11 ккал / моль] (Konevega et al., 2004). Таким образом, предтранслокационные комплексы, содержащие Ami, могут вступать в транслокацию с той же свободной энергией основного состояния, что и комплексы без антибиотика.

Амикумацин А снижает количество активных рибосом

Во время транслокации смещение мРНК и тРНК происходит как синхронное и согласованное крупномасштабное движение в межсубъединичном пространстве рибосомы (Holtkamp et al., 2014). Деацилированная тРНК перемещается с сайта P на сайт E и быстро диссоциирует от рибосомы. Перемещение пептидил-тРНК из сайта A в сайт P сопровождается сдвигом мРНК, обеспечивающим позиционирование нового кодона в сайте A, чтобы связать соответствующую аминоацил-тРНК в следующем цикле элонгации (Роднина, 2018). Ранее было показано, что добавление некоторых ингибиторов транслокации разъединяет движение акцепторного ствола тРНК и мРНК (Holtkamp et al., 2014). Здесь мы решили сравнить движение акцепторной ножки и локтевой области тРНК при добавлении Ami.Для изучения влияния антибиотика на однократную транслокацию мы использовали предтранслокационные комплексы, содержащие деацилированную тРНК fMet в P-сайте и флуоресцентно меченную fMet-Phe-тРНК Phe в A-сайте рибосомы. Чтобы охарактеризовать движение акцепторного конца тРНК от сайта A к сайту P, мы использовали Met-Phe-тРНК Phe , меченную Bodipy FL по метиониновому фрагменту (BPY-Met-Phe-tRNAPhe) (Holtkamp et al., 2014 ). Чтобы контролировать смещение центральной части тРНК при транслокации, мы использовали профлавин, присоединенный к дигидроуридину в положении 16 и / или 17, расположенном в локтевой области fMet-Phe-тРНК Phe [fMet-Phe-tRNA Phe (Prf16 / 17)] (Savelsbergh et al., 2000).

Кинетику транслокации контролировали по изменению флуоресценции при добавлении EF-G к флуоресцентно меченым предтранслокационным комплексам. При добавлении насыщающей концентрации EF-G (4 мкМ) смещение пептидил-тРНК происходило с константой скорости k = 42 с –1 для комплексов, содержащих репортер в локтевой области тРНК (Prf) и k = 22 с. –1 для комплексов, содержащих репортер на акцепторном конце тРНК (рисунки 5A, B).Интересно, что предыдущие исследования продемонстрировали значения k , близкие к 30 s –1 в случаях обоих репортеров (Holtkamp et al., 2014), что может быть связано с различными вариантами EF-G, используемыми в этом исследовании (His-tag на N -концевом конце белка) и ранее ( C -концевая His-метка).

Рис. 5. Кинетика транслокации перед установившимся состоянием, катализируемая интактными или мутантными формами EF-G. Зависимость скорости фазы быстрой транслокации от концентрации EF-G, отслеживаемая по изменению флуоресценции fMet-Phe-тРНК Phe (Prf16 / 17) (A) или BPY-Met-Phe-тРНК Phe (В) .Динамика однократной транслокации (при насыщающей концентрации EF-G (5 мкМ), отслеживаемая по изменению флуоресценции fMet-Phe-tRNA Phe (Prf16 / 17) (C) или BPY-Met-Phe- тРНК Phe (D) . Виомицин (Vio). Планки погрешностей (sd) в (A, B) были получены как минимум в двух независимых экспериментах с 5-7 техническими повторами каждый, однако не превышают размер символов.

Присутствие Ami снижает скорость смещения пептидил-тРНК от сайта A к сайту P рибосомы в два раза при мониторинге репортерами в локтевом суставе и акцепторной концевой области тРНК.При этом антибиотик не влиял на амплитуду сигнала флуоресценции и соотношение фаз быстрой и медленной транслокации [для быстрой фазы Prf: k (без Ami) = 43,6 ± 0,4 с –1 ; k (Ami) = 22,3 ± 0,2 с –1 ; BPY: k (без Ami) = 21,7 ± 0,2 с –1 ; k (Ami) = 12,6 ± 0,1 с –1 ; в обоих случаях амплитуда быстрой фазы A> 85%] (Рисунки 5C, D). Поскольку дополнительные ионы Mg 2+ стабилизируют структуру рибосомы и могут усиливать взаимодействие антибиотика с мРНК и 16S рРНК, мы исследовали кинетику транслокации при повышенной концентрации ионов Mg 2+ (20 мМ).Даже в этом случае присутствие антибиотика снижает скорость замещения пептидил-тРНК в три раза как с метками на локтевом суставе, так и с акцепторной концевой областью (дополнительный рисунок S1). Этот эффект принципиально отличался от известного для других антибиотиков, действующих на транслокацию. Напр., Виомицин связывается между двумя рибосомными субъединицами, блокирует смещение комплекса мРНК-тРНК и вращение 30S субъединицы (Holtkamp et al., 2014). При однократной транслокации виомицин препятствовал перемещению тРНК в локтевой области и увеличивал скорость реакции на ее акцепторном конце [BPY: k (Vio) = 47.2 ± 0,6 с –1 ] (Рисунки 5C, D).

Антибиотик повлиял не только на один цикл транслокации, но также значительно изменил участие рибосомы и EF-G в многооборотной транслокации. Чтобы проверить это, мы использовали пуромицин (Pmn), который связывается в сайте A посттранслоцированной рибосомы, перехватывает возникающий полипептид от пептидил-тРНК и диссоциирует (Savelsbergh et al., 2000). В анализе образования fMet- [ 14 C] Val-Pmn мы тестировали каталитические концентрации различных вариантов EF-G (дополнительный рисунок S3).Присутствие антибиотика уменьшало скорость транслокации в пять раз [ k (без Ami) = 0,103 ± 0,010 мин -1 ; k (Ami) = 0,020 ± 0,005 мин. -1 ] и уменьшил количество пептидил-тРНК, транслоцированной с сайта A на сайт P рибосомы, в три раза (рис. 6A).

Рисунок 6. Влияние Ami на многооборотную транслокацию, катализируемую интактным или G542V EF-G. (A) Динамика образования fMet- [ 14 C] вал-пуромицина. (B) Динамика образования трипептида fMet- [ 14 C] Val-Phe.

Этот эффект может быть связан с изменением вовлечения EF-G в транслокацию или снижением активности рибосомного комплекса после одного раунда транслокации в присутствии Ami. Чтобы проверить это предположение, мы провели анализ образования трипептида fMet-Val-Phe. EF-G и тройной комплекс EF-Tu⋅GTP⋅Phe-тРНК Phe были добавлены к предтранслокационным комплексам, содержащим деацилированную тРНК fMet в Р-сайте и fMet- [ 14 C] Val-тРНК Val в сайт A, с последующим отбором образцов в определенные моменты времени.Образование трипептида в присутствии антибиотика показало двухфазную кривую в отличие от однофазной кривой, полученной для интактных комплексов (фиг. 6B). Ami не влиял на быструю фазовую скорость, аналогичные скорости образования трипептида были получены в отсутствие антибиотика k (без Ami) = 0,9 ± 0,1 с –1 ; k (Ami) = 0,9 ± 0,1 с –1 . Однако быстрая фаза достигла только половины (35% из 75%) сформированной кривой амплитуды трипептида, а конечный уровень кривой был ниже даже после продолжительной инкубации (максимальная амплитуда составляла 61%).Это указывает на то, что большая часть комплексов 70S нарушена для трансляции.

Ami замедляет движение пептидил-тРНК от сайта A к сайту P рибосомы, не влияя на конформационную динамику смещения тРНК, поскольку скорость транслокации, отслеживаемая в разных частях тРНК, снижается тем же фактором. Однако результаты транслокации с множественным оборотом и образования трипептида указывают на то, что Ami значительно снижает долю рибосом, участвующих в следующем цикле элонгации.

Механизм устойчивости к амикумацину А

Встречающиеся в природе мутации могут изменять определенные компоненты системы трансляции, позволяя им нейтрализовать ингибирующие эффекты антибиотиков. Исследование таких элементов способствует выяснению не только механизма устойчивости к антибиотикам, но и молекулярного механизма действия антибиотиков. Интересно, что все обнаруженные модификации EF-G (замены G581A, G542V и вставка ins544V), обеспечивающие устойчивость к Ami, расположены более чем на 16 Å от сайта связывания антибиотика (Polikanov et al., 2014), находясь в то же время в непосредственной близости к комплексу тРНК-мРНК на рибосоме (Gao et al., 2009). Модификации принадлежат структурным элементам, которые пространственно расположены близко к двум консервативным петлям I и II [β2 – β3 (508–514 аминокислотных остатков) и β5-α B (584–590 аминокислотных остатков)] (Рис. 1). Эти петли контактируют с мРНК и антикодоновой областью пептидил-тРНК в P-сайте посттранслокационного комплекса и, предположительно, с дуплексом мРНК-тРНК в A-сайте претранслокационного комплекса (Gao et al., 2009; Tourigny et al., 2013; Лю и др., 2014). Таким образом, ожидается, что они будут сопровождать дуплекс мРНК-тРНК во время транслокации с сайта A на сайт P рибосомы. В то же время биохимические свойства и производительность in vitro вариантов EF-G не оценивались.

Сначала мы проверили стабильность белка из-за аминокислотных замен методом нано-дифференциальной сканирующей флуориметрии (Wen et al., 2020). Наши результаты показывают, что все изученные варианты EF-G имели очень похожие профили разворачивания белков, зависящих от температуры.Расчетная температура теплового перехода составила 60,8 ° C для wt EF-G, в то время как варианты EF-G отклонялись менее чем на 2 ° C (дополнительный рисунок S2), что позволяет предположить, что изучаемые аминокислотные изменения не повлияли на глобальную конформационную стабильность EF. -ГРАММ.

Во-вторых, мы изучили реакцию транслокации для всех модифицированных вариантов EF-G, показав, что они эффективно катализируют многооборотную транслокацию. Согласно анализу пуромициновой реакции образования fMet- [ 14 C] Phe-Pmn константы скорости составляли k (EF-G wt) = 0.09 ± 0,02 мин −1 , k (EF-G G542V) = 0,10 ± 0,02 мин −1 , k (EF-G ins544V) = 0,09 ± 0,01 мин −1 , k (EF-G G581A) = 0,07 ± 0,01 мин -1 при 3 нМ EF-G (дополнительный рисунок S3). Однако мутации сильно повлияли на одностороннюю транслокацию. Скорость фазы быстрой транслокации пептидил-тРНК, меченной в локтевой области, снижалась в 10–12 раз при добавлении EF-G с G581A ( k = 4.1 ± 0,1 с –1 ) или ins544V ( k = 5,2 ± 0,2 с –1 ) и 25 раз с G542V ( k = 2,1 ± 0,1 с –1 ). Соотношение фаз транслокации также изменялось с уменьшением амплитуды быстрой фазы до 60%, увеличивая вклад медленной фазы для всех мутантных форм EF-G. Интересно, что модифицированные варианты EF-G не влияли на скорость замещения пептидил-тРНК, меченой в акцепторной концевой области (G581A k = 26,3 ± 0.4 с –1 , ins544V k = 24,4 ± 0,3 с –1 , G542V k = 25,7 ± 0,3 с –1 ), а также соотношение фаз транслокации (рисунки 5A, B ). Таким образом, во время одного раунда транслокации мутантный EF-G демонстрирует сильное изменение конформационной динамики пептидил-тРНК при его перемещении с сайта A на сайт P рибосомы.

Для изучения механизма устойчивости к Ami мы использовали EF-G G542V, так как все мутантные варианты EF-G имели сходный фенотип, и этот вариант белка продемонстрировал наиболее выраженное влияние на транслокацию.В присутствии Ami однократная транслокация, катализируемая EF-G G542V, показала, что скорость замещения пептидил-тРНК с обеими метками, в локтевой и акцепторной концевой области, снижалась примерно в 2–3 раза, незначительно влияя на соотношение транслокаций. фазы [Prf: k (без Ami) = 1,65 ± 0,07 с –1 ; k (Ami) = 0,92 ± 0,02 с –1 ; BPY: k (без Ami) = 24,5 ± 0,2 с –1 ; k (Ami) = 8,9 ± 0,2 с –1 ] (рисунки 5C, D).Другими словами, изучаемый вариант EF-G изменяет конформационную динамику пептидил-тРНК во время транслокации, тогда как Ami замедляет движение тРНК, не влияя в дальнейшем на ее конформацию.

Анализ Ami-ингибированной транслокации множественного оборота, стимулированной EF-G G542V, показал пятикратное снижение скорости реакции [ k (без Ami) = 0,099 ± 0,009 с –1 ; k (Ami) = 0,024 ± 0,009 с –1 ]. Такая же степень ингибирования Ami наблюдалась для интактного EF-G.Интересно, что, несмотря на одинаковую скорость снижения, количество транслоцированной пептидил-тРНК было различным. Модифицированный вариант EF-G обеспечивал максимальную амплитуду реакции, тогда как количество транслоцированной тРНК в присутствии нативного EF-G было снижено в три раза (рис. 6А).

Скорости образования трипептида fMet-Val-Phe, поддерживаемые вариантами EF-G, были сходными [ k (EF-G) = 0,73 ± 0,08 с –1 ; k (EF-G G542V) = 0,55 ± 0,06 с –1 ] (рисунок 6B).Добавление Ami в обоих случаях приводило к превращению одноэкспоненциальной реакции в двухфазную кривую. Несмотря на задержку, вызванную второй медленной фазой, количество трипептида, образованного с EF-G G542V, достигло максимума, в то время как нативный вариант EF-G мог обеспечить только 85% трипептида.

Таким образом, при однократной транслокации Ami-резистентный вариант EF-G G542V изменяет конформационную динамику и скорость смещения пептидил-тРНК с сайта A на сайт P рибосомы.Однако в присутствии Ami участие модифицированного варианта EF-G обеспечивает переход большей части рибосом к следующему циклу элонгации по сравнению с действием интактной формы EF-G. Возможно, что изменения транслокации, вызванные EF-G G542V, поддерживают активность рибосом, связанных с амином.

Обсуждение

Наше исследование показывает, что основной механизм ингибирования трансляции Ami может быть отнесен к фазам инициации и транслокации.На этапе инициации Ami, а также другой антибиотик Ede изменяют связывание мРНК с 30S-субъединицей. В то время как Эде серьезно нарушает формирование ИС 30S, что приводит к полной неспособности производить ИС 70S, Ами действует более деликатно. Наши данные показывают, что Ami нарушает этап декодирования AUG двумя способами, немного снижает сродство мРНК к каноническому кодону AUG, но значительно увеличивает сродство к 30S-комплексам с ошибочным инициирующим кодоном UUC (Рисунок 2). Среди всех трех факторов инициации IF3 активно способствует декодированию кодонов инициации, усиливая его для AUG и подавляя другие (La Teana et al., 1993). Кроме того, прогрессирование 30S IC в сторону удлинения кинетически контролируется фактором (Milon et al., 2008). Таким образом, IF3 играет роль фактора точности. Сайт связывания Ami перекрывается с сайтом связывания IF3 (Fabbretti et al., 2007; Julián et al., 2011; Polikanov et al., 2014; Prokhorova et al., 2016), что позволяет предположить, что механизм Ami-зависимого возмущения может быть в сочетании с функциями точности IF3. Мы наблюдаем, что Ami значительно снижает скорость образования 70S IC для комплексов, содержащих модельную мРНК, запрограммированную инициирующим кодоном AUG.Интересно, что подобное снижение наблюдалось в предыдущих исследованиях, если мРНК содержала расширенную последовательность Shine-Dalgarno или неканонические инициирующие кодоны (Grigoriadou et al., 2007; Milon et al., 2008). Изменения архитектуры взаимодействия мРНК-16S рРНК, индуцированные длинным дуплексом Шайна-Далгарно анти-Шайна-Далгарно или парой кодон-антикодон при неканонической инициации, воспринимаются IF3 и определяют скорость, с которой рибосома входит в удлинение трансляции. Похоже, что связывание Ami также может быть обнаружено с помощью IF3.Действительно, исключение IF3 из реакции полностью устраняет любую разницу между присутствием или отсутствием антибиотика (рис. 3).

Наши данные также предполагают, что Ami блокирует IF3-зависимое отторжение неканонических инициирующих кодонов (Рис. 2, 3). Мы наблюдали, что Ami увеличивает количество 30S IC, образованного с инициирующим кодоном UUC, предполагая, что антибиотик увеличивает инициацию ошибочной трансляции. Однако ошибочные 30S IC не способны переходить к удлинению, так как присоединение субъединиц и аккомодация тРНК нарушены.Важно отметить, что это наблюдение усиливает двойную связь между IF3 и Ami во время инициации трансляции. Вероятный сценарий повлечет за собой блокировку IF3 антибиотиком в промежуточной конформации, которая способствует взаимодействию кодон-антикодон, но не диссоциирует.

На стадии транслокации Ami снижает скорость движения пептидил-тРНК и, что более важно, уменьшает количество рибосом, способных участвовать в следующем цикле элонгации. Этот эффект может быть связан с сайтом связывания антибиотика: Ami расположен между головным и платформенным доменами 30S-субъединицы и может присоединять 5'-конец мРНК к консервативным нуклеотидам обоих доменов (Jenner et al., 2010; Поликанов и др., 2014). Наши данные полностью подтверждают это предположение, демонстрируя, что Ami стабилизирует мРНК на 30S IC. Антибиотик замедляет движение, но обеспечивает движение комплекса мРНК-тРНК, что означает, что начальное вращение 30S-субъединицы не нарушается. В то же время потеря функциональной активности рибосом подразумевает блокировку на некоторых более поздних этапах. Существует вероятность того, что обратное вращение доменов головы и тела 30S может быть затруднено из-за их стабилизации по отношению друг к другу и удержания мРНК, однако все еще необходимы дополнительные экспериментальные доказательства, подтверждающие это предположение.

Вариант EF-G с заменой G542V приводит к 25-кратному снижению скорости движения локтевой области пептидил-тРНК с дополнительным усилением эффекта присутствием Ami. Тем не менее, этот вариант EF-G сохраняет функциональную активность рибосом во время их перехода к следующему этапу элонгации и обеспечивает устойчивость к Ami. Интересно, что все точечные аминокислотные вариации EF-G, нарушающие одностороннюю транслокацию и придающие устойчивость к Ami, не контактируют ни с антибиотиком, ни с дуплексом тРНК-мРНК: G581A находится на краю β5-цепи (рис. 1), G542V и вставка ins544V находятся в петле β4-αA (538–548 а.о.) EF-G.Эти области относятся к структурным элементам EF-G, которые практически не были изучены, поскольку их влияние на транслокацию ранее не было показано. В то же время β5-цепь и β4-αA-петля пространственно очень близки к консервативным петлям β2 – β3 (508–514 а.о.) и β5-α B (584–590 а.о.), также известным как петли I и II, которые связываются с мРНК и антикодоновой областью пептидил-тРНК в сайте P посттранслокационного комплекса и предположительно дуплексом мРНК-тРНК в сайте A комплекса перед транслокацией, сопровождая его во время транслокации с сайта A на сайт P рибосомы ( Gao et al., 2009; Tourigny et al., 2013; Лю и др., 2014).

Фенотип мутаций в петлях I и II хорошо описан, в частности, замена His583 (петля II) снижает скорость движения пептидил-тРНК в локтевой области, не влияя на транслокацию на акцепторном конце тРНК ( Savelsbergh et al., 2000; Holtkamp et al., 2014) аналогично вариантам EF-G, описанным в нашей работе. Последующее изучение петель I и II показало, что аминокислотные замены увеличивают скорость прямого вращения доменов головы и тела 30S субъединицы с сопутствующим перемещением тРНК к соответствующим сайтам и снижают скорость обратного вращения доменов и рассогласование их движения со смещением тРНК (Liu et al., 2014; Чжан и др., 2015; Peng et al., 2019). Хотя изменения последовательности EF-G, изученные в этой работе, не относятся к петлям I или II, они имеют сопоставимый эффект на смещение пептидил-тРНК и на конформационную динамику рибосом. Использование EF-G G542V значительно увеличило долю рибосом, способную перейти к следующему циклу трансляции, несмотря на ингибирующее действие Ami. Очевидно, сохранение активности рибосом связано с изменением конформации рибосом, вызванным участием модифицированного варианта EF-G в транслокации.Замена глицина на валин или введение дополнительного валина приводило к увеличению гидрофобной поверхности EF-G, контактирующей с 16S рРНК, что могло быть причиной ослабления контактов между рибосомой и фактором, снижая стабилизирующий эффект Ami. Индуцированные изменения могут быть во многом похожи на трансформации, вызванные EF-G с заменами отдельных аминокислот в петлях I и II, поскольку замедление вращения головы и тела 30S субъединицы назад и его несовпадение со смещением тРНК компенсируют стабилизирующий эффект Ami.Это наблюдение подчеркивает, что петля β4-α A и β5-цепь EF-G могут быть столь же важны для транслокации, как и тщательно изученные петли I и II, хотя первые не имеют прямых контактов с комплексом мРНК-тРНК. Таким образом, наше исследование идентифицировало элементы EF-G, которые играют важную роль в транслокации, что указывает на функциональную роль структурных элементов домена IV, которая не была показана ранее.

Ami разделяет свой сайт связывания на рибосоме с некоторыми антибиотиками, однако их механизмы ингибирования синтеза белка весьма различны.Edeine сильно подавляет инициацию трансляции, препятствуя связыванию инициаторной тРНК с сайтом P (Pioletti et al., 2001; Dinos et al., 2004). Ингибирование трансляции касугамицином неразрывно связано с последовательностью мРНК перед стартовым инициирующим кодоном (Chin et al., 1993; Schluenzen et al., 2006; Schuwirth et al., 2006; Vázquez-Laslop and Mankin, 2018) . Пактамицин действует как тРНК-специфический антибиотик и предотвращает перемещение определенных тРНК при транслокации (Dinos et al., 2004). Ami демонстрирует плейотропные эффекты на цикл трансляции на рибосоме. Во время инициации Ami искажает связывание мРНК с 30S IC, тем самым снижая скорость аккомодации инициаторной тРНК и ассоциации 50S субъединиц. На этапе транслокации антибиотик снижает скорость движения комплекса мРНК-тРНК. Однако наиболее интригующим эффектом Ami является его способность изменять функциональную активность рибосом таким образом, что только часть рибосом переходит к следующему циклу элонгации.Именно с этой особенностью справляются модифицированные варианты EF-G, проявляющие устойчивость к Ami. Предлагаемый нами основной механизм действия Ami основан как на наших данных, так и на фенотипическом сходстве модифицированных вариантов EF-G, представленных в данном исследовании (G542V, G581A и ins544V) и ранее (замены в петлях I и II). А именно, мРНК стабилизируется Ami, который взаимодействует с головой и телом 30S IC, обеспечивая прямое вращение и сильно нарушая обратное вращение головы и тела 30S IC, таким образом фиксируя рибосому в «непродуктивной» конформации. .Для подтверждения нашего предположения необходимо более детальное изучение динамики рибосомных комплексов в присутствии Ami. Однако мы можем утверждать, что Ami принадлежит к очень многообещающей группе антибиотиков, направленных на изменение конформационной динамики рибосомы.

Заявление о доступности данных

Необработанные данные, подтверждающие выводы этой статьи, будут предоставлены авторами без излишних оговорок.

Авторские взносы

EM, DV и IO проводили эксперименты.И.О. и ПК предоставили материалы. EM, DV, ON и AP проанализировали данные и создали изображения. EM, DV и AK разработали эксперименты. OD, IO, PS, PM, AP и AK разработали и организовали исследование и интерпретировали результаты. Рукопись написали EM, DV, AP, PM и AK. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Работа поддержана грантом Российского научного фонда 17-14-01416 (АК, кинетика реакций элонгации до стационарного состояния), эксперименты с различными мРНК поддержаны грантом Российского фонда фундаментальных исследований 17-00-00368 (до AK) и 17-00-00366 (к PS) мобильность между лабораториями PM и AK была профинансирована Fondo Nacional de Desarrollo Científico, Tecnológico y de Innovación Tecnológica, грант 154-2017-Fondecyt.

Конфликт интересов

АК является учредителем компании NanoTemper Technologies Rus (Санкт-Петербург, Россия), которая предоставляет услуги и устройства на основе MST и nanoDSF и представляет NanoTemper Technologies GmbH (Германия).

Остальные авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Благодарим Коляденко И.А. за помощь в анализе данных и всех участников Dr.Лаборатория Андрея Леонидовича Коневега для научных дискуссий, технической поддержки и проведения исследований. Мы благодарим доктора Марину В. Роднину за предоставление плазмид, кодирующих факторы инициации и элонгации. Мы благодарим доктора Татьяну Ефименко и доктора Ольгу В. Ефременкову (Институт новых антибиотиков Гаузе, Москва, Россия) за помощь в очистке Ami. Оборудование для измерений MST и DSF (Монолит NT.115 и Prometheus NT.48) предоставлено ООО «НаноТемпер Технологии Рус» (Санкт-Петербург, Россия).

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2021.618857/full#supplementary-material

Сокращения

Ami, амикумацин А; DSF, дифференциальная сканирующая флуориметрия; Эде, эдеине; IC, комплекс инициации; Ksg, касугамицин; MST - термофорез на микромасштабах; Pmn, пуромицин.

Список литературы

Азуми, М., Огава, К., Фудзита, Т., Такешита, М., Yoshida, R., Furumai, T., et al. (2008). Бацилосарцины A и B, новые биоактивные изокумарины с необычными гетероциклическими ядрами из бактерии морского происхождения Bacillus subtilis . Тетраэдр 64, 6420–6425. DOI: 10.1016 / j.tet.2008.04.076

CrossRef Полный текст | Google Scholar

Калоджеро, Р. А., Пон, К. Л., Канонако, М. А., и Гуалерци, К. О. (1988). Выбор области инициации трансляции мРНК рибосомами Escherichia coli . Proc. Natl. Акад. Sci. U S A. 85, 6427–6431. DOI: 10.1073 / pnas.85.17.6427

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чин К., Шин К. С. и Готтесман М. Э. (1993). Устойчивость трансляции лямбда-cI к антибиотикам, ингибирующим инициацию трансляции. Дж Бактериол . 175, 7471–7473. DOI: 10.1128 / jb.175.22.7471-7473.1993

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кунья, К. Э., Белардинелли, Р., Песке, Ф., Холткамп, В., Винтермейер, В., и Роднина, М. В. (2013). Двойное использование гидролиза GTP фактором удлинения G на рибосоме. Перевод (Остин) 1: e24315. DOI: 10.4161 / trla.24315

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Динос, Г., Уилсон, Д. Н., Тераока, Ю., Шафларски, В., Фучини, П., Калпаксис, Д., и др. (2004). Анализ механизмов ингибирования рибосом эдеина и пактамицина: универсально консервативные остатки G693 и C795 регулируют связывание РНК в Р-сайте. Mol. Клетка. 13, 113–124. DOI: 10.1016 / s1097-2765 (04) 00002-4

CrossRef Полный текст | Google Scholar

Фаббретти А., Пон, К. Л., Хеннелли, С. П., Хилл, В. Э., Лодмелл, Дж. С., и Гуалерци, К. О. (2007). Путь трансляции фактора IF3 на рибосому и от нее в реальном времени. Mol. Cell 25, 285–296. DOI: 10.1016 / j.molcel.2006.12.011

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гао, X.-Y., Liu, Y., Miao, L. –L., Ли, Э.-В., Хоу, Т.-Т., и Лю, З.-П. (2017). Механизм антивибриональной активности морского пробиотического штамма Bacillus pumilus h3 и характеристика действующего вещества. AMB Express 7:23. DOI: 10.1186 / s13568-017-0323-3

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гао, Ю. Г., Селмер, М., Данэм, К. М., Вейкслбаумер, А., Келли, А. К., и Рамакришнан, В. (2009). Структура рибосомы с фактором элонгации G находится в посттранслокационном состоянии. Наука 326, 694–699. DOI: 10.1126 / science.1179709

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гоял А., Белардинелли Р., Мараччи К., Милон П. и Роднина М. В. (2015). Направленный переход от инициации к удлинению в бактериальной трансляции. Nucleic Acids Res. 43, 10700–10712. DOI: 10.1093 / nar / gkv869

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Григориаду, К., Марзи, С., Пан, Д., Гуалерци, К. О., Куперман, Б. С. (2007). Функция точности трансляции IF3 во время перехода от инициирующего комплекса 30 S к инициирующему комплексу 70 S. J. Mol. Биол. 373, 551–561. DOI: 10.1016 / j.jmb.2007.07.031

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гуалерци, К. О., Пон, К. Л. (2015). Инициирование трансляции мРНК у бактерий: структурные и динамические аспекты. Cell. Мол. Life Sci. CMLS 72, 4341–4367.DOI: 10.1007 / s00018-015-2010-3

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Hashimoto, M., Taguchi, Ò, Nishida, S., Ueno, K., Koizumi, K., Aburada, M., et al. (2007). Выделение производных 8’-фосфатных эфиров амикумацинов: соотношение структура-активность гидроксиаминокислотного фрагмента. J. Antibiot. 60, 752–756. DOI: 10.1038 / ja.2007.99

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Holtkamp, ​​W., Cunha, C.Э., Песке Ф., Коневега А. Л., Винтермейер В. и Роднина М. В. (2014). Гидролиз GTP с помощью EF-G синхронизирует движение тРНК на малых и больших субъединицах рибосом. EMBO J. 33, 1073–1085. DOI: 10.1002 / embj.201387465

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ито, Дж., Омото, С., Шомура, Т., Нисидзава, Н., Миядо, С., Юда, Ю. и др. (1981). Амикумацин-А, новый антибиотик с сильным противовоспалительным и противоязвенным действием. J. Antibiot.(Токио) 34, 611–613. DOI: 10.7164 / антибиотики.34.611

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дженнер, Л. Б., Демешкина, Н., Юсупова, Г., Юсупов, М. (2010). Структурные аспекты поддержания рамки считывания матричной РНК рибосомой. Nat. Struct. Мол. Биол. 17, 555–560. DOI: 10.1038 / nsmb.1790

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хулиан, П., Милон, П., Агирресабала, X., Лассо, Г., Гиль Д., Роднина М. В. и др. (2011). Крио-ЭМ структура полного комплекса инициации трансляции 30S из Escherichia coli . PLoS Biol. 9: e1001095. DOI: 10.1371 / journal.pbio.1001095

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Коневега А.Л., Соболева Н.Г., Махно В.И., Семенков Ю.П., Винтермейер В., Роднина М.В. и др. (2004). Пуриновые основания в положении 37 тРНК стабилизируют взаимодействие кодон-антикодон в рибосомном сайте A за счет стэкинга и Mg2 + -зависимых взаимодействий. РНК 10, 90–101. DOI: 10.1261 / rna.5142404

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ла Теана, А., Пон, К. Л., и Гуалерци, К. О. (1993). Трансляция мРНК с вырожденным триплетом инициации AUU демонстрирует высокую зависимость от фактора инициации 2 и подвержена репрессии фактора инициации 3. Proc. Natl. Акад. Sci. США 90, 4161–4165. DOI: 10.1073 / pnas.90.9.4161

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лама, А., Панэ-Фарре, Дж., Чон, Т., Виерсма, А. М., Сит, К. С., Ведерас, Дж. К. и др. (2012). Ответ метициллин-устойчивого золотистого стафилококка на амикумацин A. PLoS One 7: e34037. DOI: 10.1371 / journal.pone.0034037

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Li, Y., Xu, Y., Liu, L., Han, Z., Lai, P.Y., Guo, X., et al. (2012). Пять новых амикумацинов, выделенных из бактерии морского происхождения Bacillus subtilis . Мар. Наркотики 10, 319–328.DOI: 10.3390 / md10020319

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Li, Y. X., Li, Z. R., Yamanaka, K., Xu, Y., Zhang, W. P., Vlamakis, H., et al. (2015). Направленный захват и экспрессия кластера генов биосинтеза природного продукта в модельной бактерии Bacillus subtilis. Sci. Отчет 5: 9383. DOI: 10.1038 / srep09383

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лю, Г., Сун, Г., Чжан, Д., Ли, З., Лю, З., Дун, Дж., и другие. (2014). EF-G катализирует транслокацию тРНК, нарушая взаимодействия между декодирующим центром и дуплексом кодон-антикодон. Nat. Struct. Мол. Биол. 21, 817–824. DOI: 10.1038 / nsmb.2869

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Макинерни, Б. В., Тейлор, В. К., Лейси, М. Дж., Ахерст, Р. Дж., И Грегсон, Р. П. (1991). Биологически активные метаболиты из Xenorhabdus spp., Часть 2. Производные бензопиран-1-она с гастропротекторной активностью. J. Nat. Prod. 54, 785–795. DOI: 10.1021 / np50075a006

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Милон П., Коневега А. Л., Гуалерзи К. О. и Роднина М. В. (2008). Кинетическая контрольная точка на позднем этапе инициации трансляции. Mol. Клетка. 30, 712–720. DOI: 10.1016 / j.molcel.2008.04.014

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Милон, П., Коневега, А. Л., Песке, Ф., Фаббретти, А., Гуалерци, К.О., Роднина М.В. (2007). Переходная кинетика, флуоресценция и FRET в исследованиях инициации трансляции у бактерий. Methods Enzymol. 430, 1–30. DOI: 10.1016 / S0076-6879 (07) 30001-3

CrossRef Полный текст | Google Scholar

Нгуен, Ф., Староста, А. Л., Аренц, С., Сомен, Д., Дёнхёфер, А., и Уилсон, Д. Н. (2014). Тетрациклиновые антибиотики и механизмы устойчивости. Biol. Chem . 395, 559–575. DOI: 10.1515 / hsz-2013-0292

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Остерман, И.А., Хабибуллина, Н. Ф., Комарова, Е. С., Касацкий, П., Карцев, В. Г., Богданов, А. А. и др. (2017). Мадумицин II ингибирует образование пептидной связи, переводя центр пептидилтрансферазы в неактивное состояние. Nucleic Acids Res . 45, 7507–7514. DOI: 10.1093 / nar / gkx413

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пан, Д., Чжан, К. М., Кириллов, С., Хоу, Ю. М., и Куперман, Б. С. (2008). Нарушение третичного ядра тРНК по-разному влияет на определенные стадии цикла элонгации. J. Biol. Chem. 283, 18431–18440. DOI: 10.1074 / jbc.M801560200

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пэн Б.-З., Бок Л.В., Белардинелли Р., Песке Ф., Грубмюллер Х. и Роднина М. (2019). Активная роль фактора элонгации G в поддержании рамки считывания мРНК во время трансляции. Sci. Adv. 5: eaax8030. DOI: 10.1126 / sciadv.aax8030

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пинчук, И.В., Брессолье П., Сорокулова И. Б., Верней Б. и Урдачи М. К. (2002). Производство амикумациновых антибиотиков и генетическое разнообразие штаммов Bacillus subtilis , выделенных из различных местообитаний. Res. Microbiol. 153, 269–276. DOI: 10.1016 / s0923-2508 (02) 01320-7

CrossRef Полный текст | Google Scholar

Пинчук И. В., Брессолье П., Верней Э., Фенет Э., Сорокулова И. Б., Мегро Ф. и др. (2001). In vitro анти- Helicobacter pylori активность пробиотического штамма Bacillus subtilis 3 обусловлена ​​секрецией антибиотиков. Антимикробный. Агенты Chemother. 45, 3156–3161. DOI: 10.1128 / AAC.45.11.3156-3161.2001

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Pioletti, M., Schlunzen, F., Harms, J., Zarivach, R., Gluhmann, M., Avila, H., et al. (2001). Кристаллические структуры комплексов малой субъединицы рибосомы с тетрациклином, эдеином и IF3. EMBO J. 20, 1829–1839. DOI: 10.1093 / emboj / 20.8.1829

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Поликанов, Ю.С., Остерман И. А., Сзал Т., Ташлицкий В. Н., Серебрякова М. В., Кусочек П. и др. (2014). Амикумацин А подавляет трансляцию, стабилизируя взаимодействие РНК с рибосомой. Mol. Клетка. 56, 531–540. DOI: 10.1016 / j.molcel.2014.09.020

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Прохорова И.В., Акулич К.А., Макеева Д.С., Остерман И.А., Скворцов Д.А., Сергиев П.В. и др. (2016). Амикумацин А вызывает гибель раковых клеток, воздействуя на эукариотические рибосомы. Sci. Отчет 6: 27720. DOI: 10.1038 / srep27720

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Роднина, М. В., Фрике, Р., Кун, Л., и Винтермейер, В. (1995). Кодон-зависимое конформационное изменение фактора элонгации Tu, предшествующее гидролизу GTP на рибосоме. EMBO J. 14, 2613–2619. DOI: 10.1002 / j.1460-2075.1995.tb07259.x

CrossRef Полный текст | Google Scholar

Роднина М. В., Винтермейер В. (1995). Потребление GTP фактора элонгации Tu при трансляции гетерополимерных мРНК. Proc. Natl. Акад. Sci. США 92, 1945–1949. DOI: 10.1073 / pnas.92.6.1945

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Савельсберг А., Матасова Н. Б., Роднина М. В., Винтермейер В. (2000). Роль доменов 4 и 5 в функции фактора удлинения G на рибосоме. J. Mol. Биол. 300, 951–961. DOI: 10.1006 / jmbi.2000.3886

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шлюенцен, Ф., Такемото, К., Wilson, D. N., Kaminishi, T., Harms, J. M., Hanawa-Suetsugu, K., et al. (2006). Антибиотик касугамицин имитирует нуклеотиды мРНК, дестабилизируя связывание тРНК и ингибируя инициацию канонической трансляции. Nat. Struct. Мол. Биол. 13, 871–878. DOI: 10.1038 / nsmb1145

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шувирт, Б.С., Дэй, Дж. М., Хау, К. В., Янссен, Г. Р., Дальберг, А. Е., Кейт, Дж. Х. и др. (2006). Структурный анализ ингибирования трансляции касугамицином. Nat. Struct. Мол. Биол. 13, 879–886. DOI: 10.1038 / nsmb1150

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Семенков Ю.П., Макаров Э.М., Махно В.И., Кириллов С.В. (1982). Кинетические аспекты действия тетрациклина на акцепторном (A) сайте рибосом Escherichia coli . FEBS Lett. 144, 125–129. DOI: 10.1016 / 0014-5793 (82) 80584-x

CrossRef Полный текст | Google Scholar

Симодзима Ю., Хаяси Х., Оока, Т., и Шибукава, М. (1982). (Исследования AI-77, микробных продуктов с фармакологической активностью) структуры и химическая природа AI-77. Тетраэдр. Lett. 23, 5435–5438. DOI: 10.1016 / s0040-4039 (00) 85861-x

CrossRef Полный текст | Google Scholar

Sun, W., Zhang, Y.Q., Huang, Y., Zhang, Y.Q., Yang, Z.Y., и Liu, Z.H. (2009). Nocardia jinanensis sp. nov., актиномицет, продуцирующий амикумацин B. Внутр. J. Syst. Evol. Microbiol. 59, 417–420. DOI: 10.1099 / ijs.0.002899-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Терехов С.С., Смирнов И.В., Малахова М.В., Самойлов А.Е., Манолов А.И., Назаров А.С. и др. (2018). Сверхвысокопроизводительное функциональное профилирование сообществ микробиоты. Proc. Natl. Акад. Sci. США 115, 9551–9556. DOI: 10.1073 / pnas.1811250115

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Туриньи, Д.С., Фернандес, И.С., Келли, А.С., и Рамакришнан, В. (2013). Фактор элонгации G связан с рибосомой в промежуточном состоянии транслокации. Наука 340: 1235490. DOI: 10.1126 / science.1235490

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Виноградова Д. С., Зегарра В., Максимова М., Накамото Дж. А., Касатский П. С., Палескава А. и др. (2020). Как инициирующая рибосома справляется с ppGpp для трансляции мРНК. PLoS Biol. 18: e3000593.DOI: 10.1371 / journal.pbio.3000593

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вен Дж., Лорд Х., Кнутсон Н. и Викстрём М. (2020). Нано-дифференциальная сканирующая флуориметрия для исследований сопоставимости терапевтических белков. Анал. Biochem. 15: 113581. DOI: 10.1016 / j.ab.2020.113581

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Виден, Х. Дж., Громадски, К., Роднин, Д., и Роднина, М. В. (2002). Механизм фактора элонгации (EF) -Ts, катализируемого обменом нуклеотидов в EF-Tu.Вклад контактов на гуаниновой основе. J. Biol. Chem. 277, 6032–6036. DOI: 10.1074 / jbc.M110888200

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Винтермейер, В., Робертсон, Дж. М., и Захау, Г. Г. (1980). Флуоресцентные производные тРНК и распознавание рибосом. Mol. Биол. Biochem. Биофиз. 32, 368–375. DOI: 10.1007 / 978-3-642-81503-4_28

CrossRef Полный текст | Google Scholar

Чжан Д., Янь К., Чжан Ю., Лю, Г., Цао, X., и Сун, Г. (2015). Новое понимание ферментативной роли ef-g в рециклинге рибосом. Nucleic Acids Res. 43, 10525–10533. DOI: 10.1093 / nar / gkv995

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Майя Донцова покидает проект? Биография Май из дома 2.

Уже много дней подряд парочку Майи Донцовой и Алексея Купина разбирают на трансляциях шлок ... У меня вопрос - а почему? Кому может быть интересна эта тема после того, как она обсуждалась не менее двух раз подряд?

Но меня смешит даже не упорство редакторов, раскручивающих эту тему.Я лично удивлен, как ведущая Юлия Ефременкова постепенно снимает маску доброго, заботливого, искреннего, внимательного ведущего и возвращает свое истинное лицо, столь знакомое зрителям проекта.
В дневной трансляции с Острова Любви на шлоке от 21.10.2018 реакция, приведшая к просьбе Донцовой покинуть отель без камер для отдыха, вызвала у Юлии множество вопросов - от чего ты устала , сколько, о каком отдыхе можно говорить?
Похоже, что все, кто раньше побывал в отеле, - самые уставшие люди в мире и заслуживают отдыха.


Помню момент, когда в прошлом году Алеша Купин был в истерике и попросил уйти. И как сделали ведущие - отправили парня, даже не вдаваясь в подробности. Но почему-то решили замариновать Маюшу. Может, они готовят публике приятный сюрприз?

»На канале ТНТ.

Майя Донцова. Биография

Майя Донцова родилась 20 мая 1992 года в Ростове. Майя по профессии юрист.В 2014 году окончила РТА (Российская таможенная академия). Она работала в следственном комитете, но через год уволилась. Затем девушка работала в Америке и Европе, где специализировалась на заключении международных контрактов.

Майя приняла участие в играх команды КВН своего вуза. Четыре года она выступала в КВН, а затем ее пригласили в родную академию в качестве члена жюри. Майя Донцова также принимала участие в организации праздников и различных мероприятий.

Любит путешествовать: побывал в Италии, Тунисе, Америке, Германии и Швейцарии.Занимается йогой, любит готовить и любит делать покупки. До прихода в Дом 2 у Майи Донцовой были отношения, которые длились два года, однако пара рассталась из-за частых командировок молодого человека, которые он пытался компенсировать деньгами.

Майя Донцова в шоу Дом 2

Майя Донцова пришла на реалити-шоу 8 июля 2016 года и проявила симпатию к Денису Козловичу, но отношения продлились недолго. Затем девушка переключилась на Ивана Барзикова, но и здесь история любви не сложилась, однако молодые люди остались хорошими друзьями.Затем девушку составили в пару с Захаром Саленко, пока парня не отправили повестку в армию. Не дожидаясь возвращения Захара, Майя поспешила прекратить отношения на расстоянии. Но через некоторое время Захар вернулся в проект, но больше не хотел строить отношения с «предателем».

В результате Майя начала строить отношения с Алексеем Купиным. Однако пара столкнулась с испытанием. В сентябре на проект пришла бывшая девушка Алексея, и Майе это по понятным причинам не понравилось.

Майя Донцова: «Его бывшая не только приехала к Леше на проект, но и поддерживает с ней связь. И более чем дружелюбно! Я не считаю Карину соперницей, но боюсь, что их чувства могут снова вспыхнуть. «

В ноябре 2017 года они отправились на Остров Любви. По словам девушки, по прибытии на остров в паре выявилось большое количество проблем. И одна из глобальных проблем - они так и не научились уступать каждому. др. Также недовольна выбором дочери мама Майи Ирина Донцова .Женщина неоднократно выходила в периметр и ссорилась с Купиным, уверяя, что Леша не годится для Майи. Однако вскоре юноше удалось прийти к мирному соглашению с будущей свекровью, и они вместе готовились к торжеству. «Мамы помогают нам подготовиться к свадьбе. С каждым днем ​​забот становится больше, а до свадьбы остается все меньше », - признался Купин.

Донцова и Купин хотели пожениться еще в 2018 году. Однако из-за воспаления аппендикса Купина госпитализировали, после чего мероприятие сорвалось.

8 августа 2019 года Алексей Купин и Майя Донцова поженились в ЗАГСе им. Вернадского в Москве. На саму церемонию Алексей и Майя никого не приглашали - на картине присутствовали только двое. Главное торжество они запланировали на 19 августа. Купина и Донцова объяснили свое решение тем, что комната, которую они хотели снять, чтобы отпраздновать столь важное событие в кругу семьи и друзей, свободна только с 18 по 21 числа. Влюбленные организовали праздник в стиле современного Голливуда: украшения были выполнены в серебристом и белом цвете с добавлением темно-красного и золотого, а гостей встречали красной ковровой дорожкой, мороженым, мимами и выездным баром.

На саму свадьбу Майя и Леша потратили миллион рублей, которые они выиграли в конкурсе «Свадьба на миллион», а также часть своих сбережений. Поэтому супруги решили не экономить. Кроме того, невеста хотела обойтись без живых цветов, кроме букета.

Ростовская красавица Майя Донцова родилась 25 мая 1992 года. До прихода в проект «Дом-2» девушка не была известна. После окончания Российской таможенной академии она строила карьеру юриста, успешно применяя полученные знания как дома, так и в Европе и Америке.

Серьезное занятие Майи может ввести людей в заблуждение по ее мнению. Многим покажется, что Донцова проста и предсказуема, но характер девушки не такой. Недаром она активно участвовала во многих мероприятиях своего вуза, в том числе в составе команды КВН. А чтобы подзаработать, девушка работала организатором торжеств.



Майя признается в любви к покупкам и путешествиям, но ее поклонники склонны замечать за ее спиной еще одну пристрастие - перемены.Как и многие участницы и участницы вечного телевидения, Майя не могла устоять перед соблазном изменить свою внешность с помощью косметических процедур и хирургии.

Нельзя сказать, что Донцова переборщила, но ее внешность все же претерпела метаморфозы после пластических операций.




Специалисты Майе Донцовой относят к ринопластике, увеличению и коррекции губ, применению филлеров, коррекции скул, изменению формы бровей, возможно увеличение и / или коррекцию груди, липосакции в области живота и бедер.



К тому же девушка часто меняет имидж, а в последнее время Майя тоже сильно похудела, наконец-то подогнав фигуру под популярные сейчас в бомонде стандарты сочно-худой.

Прискорбно видеть, как Майя на проекте «Дом-2» постепенно становится похожей на остальных участниц не только внешне, но и скандально.



Возраст: 27 лет

г. Москва

Рост: 170 см Вес: 54 кг

1139 дней по проекту

Майя Донцова родилась в Ростове, подростком переехала с родителями в Москву.В российской столице мама девочки организовала ювелирный бизнес, который процветает до сих пор.

Девочка росла активная и любознательная, увлекалась танцами и пением. Еще будучи школьницей, она изо всех сил экспериментировала со своей внешностью: она оказалась платиновой блондинкой, затем жгучей брюнеткой. С аттестатом зрелости в кармане Майя пошла в Российскую таможенную академию, поступив без проблем. Она быстро покорила сердца одноклассников неподражаемыми номерами, которые продемонстрировала в составе студенческой лиги КВН от академии.

Во время учебы Майя Донцова проходила стажировку в Следственном комитете, что отговорило ее от связывания будущего с профессией - ей пришлось столкнуться с человеческой жестокостью. Выпускник Академии заключил международные контракты, работая в филиале московской компании в США и Европе. А потом решила, что в жизни не хватает творчества, и перешла в сферу организации праздников. Интересная работа тоже была прибыльной.

До проекта у девушки были серьезные отношения, которые длились 2 года.Молодые люди разошлись, потому что парень все время пытался ее откупить. Он дал деньги, чтобы она его не трогала.

Майя Донцова появилась в Доме 2 в середине лета 2016 года. Девушка пришла в себя, определив свои качества заочно - по телевизору молодой человек показался «настоящим мужчиной с крепким стержнем», что гарантирует женщине заботу, внимание и защита. Плюс меня привлекла нестандартная внешность красавца-участницы шоу. Майя даже подарила своей избраннице цветок.

Но молодой человек не сразу ответил Донцовой взаимностью, зато регулярно проявлял расположение - готовил завтраки и осыпал шикарными букетами. Отношения закончились, когда Козлович предпочел Дом 2 танцевальному шоу, поспешив уйти от телевизора. Пара некрасиво рассталась - Денис ушел обиженный, ревновавший возлюбленную к другому участнику.

Следующим претендентом на сердце Майи был. Дело осложнилось тем, что молодой человек познакомился с подругой Донцовой Дарьей Сухорученко.Все закончилось феерической дракой между девушками с вырванными волосами и синяками. Красавица также пострадала от рук, из которых она тоже пыталась отвести парня. Тогда девочке по голове досталась сковорода. После непродолжительного романа Майя Донцова и Иван Барзиков решили остаться друзьями.

Немного отдохнув от отношений, Майя Донцова попыталась создать пару, но союз не выдержал скандалов и интриг. Кроме того, против молодого человека взбунтовалась мать героини Ирина Михайловна.Также девушки оказались в списке влюбленных, экстрасенс Денис Высоцкий и. Из-за неудач на любовном фронте жители Дома 2 дали Донцовой прозвище «Черная Вдова».

Зрители с любопытством наблюдали за коллизиями, разворачивающимися на проекте с участием родительницы Донцовой. Ирина Михайловна приехала на шоу Дом-2, чтобы хоть как-то помочь дочери наладить личную жизнь. Оценив ситуацию и имеющихся претендентов на руку и сердце наследницы, женщина посоветовала обратить внимание на Максима Локоткова.Дочь даже не думала рассматривать юношу как любовника, тогда Ирина Михайловна решила приставать к Максу сама. В результате мать и дочь поссорились.

Наконец-то остановилась Майя, с которой она даже попала на Сейшелы. Впрочем, в солнечном раю тоже не было спокойно - между Донцовой и девушкой Саленко разгорелся скандал. Захар пытался ухаживать за обеими девушками.

Роман с Алексеем Купиным оказался долгим, несмотря на трудности.Пара очень часто выясняла отношения, однако у пары было много приятных моментов. Так Леша подарил Майе белоснежного щенка породы шпиц, которого назвали Персик.

Долгое время Купин вел себя как искренне влюбленный: дарил подарки, приносил завтрак в постель, встал на сторону девушки в конфликтах, которые вспыхивали между ней и другими участниками проекта. А вскоре совсем удивился, сделав Донцовой предложение руки и сердца. Даже ведущие не ожидали такого поспешного решения, ведь так быстро на шоу никто не женился.И все же они поддержали Купина, пообещав помочь в подготовке к свадьбе.

Перед свадьбой пара отправилась на Сейшелы. Предполагалась романтическая поездка, но Алексей и Майя вдруг стали сильно ругаться. Разные взгляды молодежи на дальнейшую жизнь стали причиной конфликтов. У Купина есть загородный дом на берегу моря недалеко от Одессы, и молодой человек мечтает поселиться в нем со своей избранницей. Он не позволит жене работать, я уверен, что жена, прежде всего, мать и домохозяйка, которая создает комфорт для семьи.Делать деньги - это мужская работа. У Майи иное видение своей судьбы. Девушка хочет жить в Москве, построить карьеру, создать собственный бизнес. Громкие скандалы в итоге привели к тому, что Майя и Леша расстались. Однако ненадолго. Донцова сделала все, чтобы помириться с любимым.

Зимой пара заговорила о детях, когда врачи поставили ей неутешительный диагноз и посоветовали как можно быстрее решить вопрос с ребенком. Майя начала давить на Алексея, но тот поначалу сопротивлялся, мотивируя это тем, что еще не готов к таким трудностям и ответственности.В результате молодые люди по решению телезрителей ток-шоу были лишены возможности дальнейшего участия в конкурсе «Свадьба на миллион», который проводился по телеканалу. Провалившие первый тур Донцова и Купин сочли приговор несправедливым, ведь на проекте вряд ли можно найти пару, уже готовую создать семью и завести детей.

В конце апреля 2018 Алексей сделал Майе еще одно предложение руки и сердца, свадьба была назначена на август.В качестве свидетелей были выбраны молодые люди и. Подготовка к свадьбе шла полным ходом, девушке даже удалось побывать в свадебном салоне, но свадьба в итоге была отложена.

Поклонники проекта не верят, что торжество состоится. Якобы Алексей недоволен рядом с Майей. В то же время советуют послушать Вселенную, которая вроде бы против этой свадьбы. То ли болезнь обрушивается на молодого человека в виде острого аппендицита, то возникают препятствия, связанные с документами.

Когда пара уже подготовила практически все к официальной свадьбе на Сейшельских островах, со здоровьем Майи случились проблемы. Девушка попала в больницу и сейчас ей предстоит длительное лечение, свадьбу снова отменили. Молодые люди уже склонны к варианту тайно расписаться и объявить всем о своем семейном положении после картины.

Страница Майи Донцовой Вконтакте.

Имя участника: Майя Донцова
Возраст (день рождения): 20.05.1992
Город: Москва
Образование: РТА, юрист

Майя Донцова в соцсетях:

В контакте: vk.com/mayyadonz
Instagram: https://www.instagram.com/mayyadonz/?hl\u003dru

В Москве родилась девочка. А именно: 20 мая 1992 года рождения. Майя по образованию юрист, окончила Таможенную академию. После окончания учебы девушка проходила практику в следственном отделении.Поэтому у девушки хороший опыт, она образована и знает себе цену.

Когда девушка была студенткой, она участвовала в КВН. У нее были серьезные отношения еще до проекта. Она встречалась со своим парнем около двух лет. Но свою вторую половину мужчина не уважал. А девушка всегда была самодостаточной, хорошо зарабатывала. Поэтому эти отношения были обречены на провал. Девушка больше не могла терпеть унижения и оскорбления. Исход этих отношений был полностью предсказуем.

Девушка попала на проект неспроста, она целенаправленно пришла к Денису Козловичу. Но их любовь не сложилась, это связано с уходом юноши из программы. Девушка рассказала нам, что почувствовала в нем твердый стержень. Он делал сильные поступки, а главное, его поступки были мужскими.

Когда девушка завела отношения с Иваном Барзиковым, это закончилось только дружбой. Но красивой любви, увы, не сложилось. И она осталась только во сне.

После неудачи девушка стала соревноваться с другими дамами за внимание Тимура. Девочки даже поссорились из-за этого человека.

Следующим женихом девушки стал Максим Локотков. Но этот человек пришел к Майе и вызвал сочувствие у матери Майи. Мать девушки хотела себе такого зятя, но когда узнала, что мужчина ранее встречался со зрелыми женщинами, решила построить с ним отношения. Эта история очень удивила участников проекта.Они долго обсуждали все, что происходило на проекте.


Далее Мэй начала отношения с Захаром Соленко. Такие отношения были самыми яркими и запоминающимися. Но сегодня молодые люди не состоят в отношениях. У них было много скандалов, и отношения они уладили бурно. Били посуду и шумно слушали. Но грусть длилась недолго.


Мать Майи принимала участие в жизни собственной дочери. Алексей Купин пришел на программу Майи.Девушка ему понравилась с первого взгляда. Молодые люди уехали на Сейшелы. Они тут же устроили пышную свадьбу.

Следует отметить, что молодые люди очень хорошо смотрятся друг с другом, это красивая и лаконичная пара. После свадьбы молодые люди вернулись на поляну, а затем снова отправились на остров любви.

Донцова прибытие домой 2. Майя Донцова покидает проект? Биография Майи Донцовой

День подряд в эфире на шлоке разобрали парочку Майи Донцовой и Алексея Купина... У меня вопрос - почему? Кому может быть интересна эта тема после того, как она обсуждалась не менее двух раз подряд?

Но даже упорство редакторов, раздувающих эту тему, меня не забавляет. Лично меня удивляет, как телеведущая Юлия Ефременкова постепенно снимает маску доброй, заботливой, искренней, внимательной телеведущей и возвращает ей истинное лицо, столь знакомое зрителям проекта.
В дневной трансляции с острова Любви на Слоке 21.10.2018 реакция, приведшая к просьбе Донцовой покинуть отель без камер для отдыха, вызвала у Юлии множество вопросов - от чего вы устали, насколько, о каком отдыхе можно говорить?
Похоже, что все, кто раньше бывал в отеле, - самые уставшие люди в мире и заслуживают отдыха.


Я вспоминаю момент, когда в прошлом году Алеша Купин в истерике дрался и просил уйти. И так же ведущие отправили парня, даже не вдаваясь в подробности. Но Маюша почему-то решила замариновать. Может, они готовят публике приятный сюрприз?

Угадайте, в каком месяце родился участник проекта? Да, в мае. 20 мая 1992 года привлекательная блондинка отмечает день рождения.

Естественный оттенок волос Майи - темно-коричневый, а глаза - темно-карие.

Девочка ходила в самую обычную московскую школу, любила участвовать в различных мероприятиях и была очень активным и активным ребенком.

Непослушная девочка в молодости часто меняла внешность. Сегодня она была яркой блондинкой, а на следующий день жгучей брюнеткой. При ее невысоком росте всего 162 сантиметра очаровательная участница смогла выгодно выделиться на фоне остальных.

После окончания школы, выпускница подала документы в один из вузов города.

Образование


С присущей Майе легкостью она поступает в Российскую таможенную академию и заканчивает ее в 2014 году.

Параллельно с учебой, с третьего курса дама с детективной фамилией устроилась на работу в следственный комитет. По словам Донцовой, работа была непростой, тяжелой. Через год она уволилась.

Студентка решила попробовать себя в другом юридическом направлении.


В студенческие годы Майя активно играла в клубе, весела и находчива, проста в КВН.Четыре года она развлекала детей своими яркими номерами. Девушку по-прежнему приглашают в академию в качестве члена жюри.

Работа


Выпускное направление высшего учебного заведения, трудовая деятельность Майи Донцовой была связана с заключением международных договоров. Талантливый юрист полгода провел в Америке и Европе.

Недавно блондинка переквалифицировалась и начала работать в сфере организатора мероприятий в Москве. Она хорошо зарабатывает и может полностью содержать себя.

Увлечения Майя


Как выяснилось, девушка с весенним именем довольно активна и просто любит путешествовать. Список завоеванных ею стран уже содержит:

  • Страстная Италия.
  • Горячий Тунис.
  • Ослепительная Америка.
  • Педантичная Германия.
  • Точная и строгая Швейцария.

Донцова тоже любит свой родной город, старается не пропускать многочисленные вечеринки и мероприятия с многочисленными друзьями.

В хобби ослепительной блондинки также входят:

  1. Урок йоги.
  2. Готовим по новым кулинарным рецептам.
  3. Размещайте новые фото в социальных сетях. Все поклонники могут регулярно следить за изменениями в жизни любимой участницы.
  4. Сходите по магазинам с мамой.

Любопытный факт


Нельзя игнорировать тот факт, что Майя Донцова прибегла к помощи пластических хирургов. Если вы внимательно посмотрите на прошлые фото девушки и современные снимки, то заметите очень существенные различия во внешности.

Хотя, многие фанаты утверждают, что это ничем не подтвержденные необоснованные слухи. Девушка просто немного повзрослела и, несомненно, похорошела, стала более ухоженной, но пластикой не стала. Сама барышня никакой информации об этом не дает.

Участие в проекте

Перед тем, как прийти на передачу, у блондинки были отношения. Два года она встречалась с молодым человеком, но пара рассталась. Парень пытался компенсировать частые отлучки деньгами и отказывался проводить много времени вместе.

Майя пришла на проект 8 июля 2016 года. Она сочувствовала Денису Козловичу. Блондинке понравился его сильный характер и необычная внешность. Парня не сразу заинтересовала хорошенькая девушка, но через время он начал проявлять к ней интерес. А теперь смелый Дэн готовит завтраки и дарит любимым шикарные букеты.

Отношения продлились недолго. Денис начал ревновать Майю к Ивану Барзикову. Участница хоть и не скрывала интереса к парню, но вела себя сдержанно.Но у Ивана есть любовница, а то и по совместительству подруга Майи Дарья Сухоручено.

Страсть Ивана, несмотря на близкие отношения с Донцовой, перестала быть верной подруге и затеяла драку. Красавицы сильно поссорились, и не без рваных волос, синяков и шишек. Примирятся ли друзья? Время покажет.

После этого происшествия участница какое-то время была одна, после чего попыталась построить любовь с Захаром Соленко. Надо сказать, роман получился у ребят ярким и страстным.Были и жестокие разборки, и закулисные интриги, и громкие скандалы, и сентиментальное примирение. Но пара рассталась.

Любопытно, что мама Майи активно советовала дочери, рассказывая, как вести себя в отношениях с парнями.

И снова Майя Донцова одна. Она ищет свою любовь, ждет прихода новых, достойных парней.

Майя Донцова - известная участница телепроекта «Дом 2» с красивым весенним названием.В столь юном возрасте обширная биография девушки очень интересна зрителям шоу. С первого же дня участия в телешоу юная леди покорила сердца как коллег по площадке, так и большой аудитории. Красавица-блондинка изначально производила впечатление ветреной девушки, но вскоре выяснились интересные факты ее биографии.

Биография Майи Донцовой

Как ни странно, эта милашка отмечает свой день рождения 20 мая 1992 года.Майя родилась в Ростове, с рождения девочка была хорошенькой: с темно-карими глазами и русыми кудрями. Когда Ростов был подростком, ее семья переехала в Москву, где мама организовала ювелирный бизнес. Девушка окончила обычную московскую школу, активно участвовала во внеклассной деятельности школы: пела, танцевала, была веселым и активным подростком.

Еще в школе девочка любила экспериментировать со внешностью. На фото Майи Донцовой видно, что цвет ее волос варьировался от жгучей брюнетки до агрессивно обесцвеченной блондинки.При миниатюрном росте 162 сантиметра она выиграла среди одноклассников благодаря своему природному обаянию и открытой улыбке.

Воспитание яркой участницы Дом 2

Без особого труда красавица поступила в Российскую таможенную академию, которую успешно окончила в 2014 году. Но не только руководитель юной студентки был занят учёбой, с третьего курса в следственном комитете работала эффектная дама с детективной фамилией. .

Работа была тяжелой и очень сложной, поэтому поработать ей удалось всего год, после чего девушка решила, что эта работа ей не по душе.В свободное время ученица занималась в клубе веселых и находчивых (КВН). Четыре года юный комик развлекал публику яркими феерическими номерами. До сих пор бывшую КВНщицу приглашали в жюри студенческой лиги Академии КВН.

Где работала Майя

По окончании обучения в академии трудовая деятельность нашей героини была связана с заключением международных договоров, поэтому около полугода она провела на работе в Европе и Америке.

В последние годы блондинка сменила специализацию, и она стала работать в сфере организации развлекательных мероприятий в Москве, что неплохо зарабатывает.

По ее словам, она сама полностью обеспечивает свои потребности. Также в круговороте яркой жизни она любит посещать вечеринки в Москве со многими друзьями.

Участие в доме 2

Перед съемками у красавицы сложились неудачные отношения.Примерно через пару лет она познакомилась с парнем. После разрыва девушка пожаловалась на то, что молодой человек очень сосредоточен на финансах. Я всегда старался компенсировать свои недостатки деньгами и заменять свое внимание зелеными купюрами.

  • Прибытие в Дом-2 состоялось 8 июля 2016 года. Будущий участник появился на площадке с розой, предназначенной Денису Козловичу. Красавице очень понравился мужской характер, серьезность и необычная внешность участницы.Денис не сразу обратил внимание на новоиспеченную хозяйку, но со временем стал готовить ей завтраки и носить шикарные букеты. Отношения продлились недолго, потому что Денис ревновал возлюбленную, и в этот момент ему предложили поучаствовать в танцевальном шоу. Обиженный парень ушел и от своей возлюбленной, и из проекта.

  • Следующим в списке постоянно влюбляющихся в красоту был Иван Барзиков. Препятствием стала девушка уже в парне, по совместительству, тоже подруга Майи Дарья Сухорученко.Поначалу верная Дарья не хотела спорить с подругой, потому что последняя вела себя сдержанно, но вскоре перешла к активным действиям. Тогда пассия Ивана устроила с Донцовой драку.
В результате драки Майи Донцовой и Сухорученко остались только рваные клочки волос, шишки и синяки. После инцидента пыл домохозяек сильно закалился.

  • Некоторое время девушка была одна, но вскоре попыталась построить отношения с Захаром Саленко.Между партнерами кипели мексиканские страсти: громкие разборки, закулисные интриги, сентиментальные примирения и снова скандалы. В результате пара также распалась.

  • В списке сердцеедов - Илья Грин и Денис Баранов. Но отношения с Алексеем Купиным привели москвича на Сейшелы, где Захар Саленко и уже поселился. Между девушками произошла драка, потому что Захар развратил обоих участников.

  • Нельзя игнорировать отношения Майи не с молодежью, а с собственной матерью.Казалось, все видели стены Дома 2: роман юной Ирины Агибаловой с мачо Самсоновым, драку мамы Гобозовой с невесткой и ее «эпическую» попытку самоубийства и даже демонстрацию материнского самоубийства. голая пятая точка.

Но следующий проект maman превзошел всех. Они с дочерью прижались друг к другу, не деля кавалера Максима Локоткова. Напомним, Ирина Михайловна Донцова пришла на проект из-за того, что дочь получила прозвище «черная вдова» из-за ряда неудачных отношений.

Пластмассы Майя Донцова

Нельзя закрывать глаза на то, что внешность девушки изменилась с момента ее прихода на проект до сегодняшнего дня. Изучая инстаграм участницы Дома 2, поклонники пришли к выводу, что на фото Майя Донцова до и после пластической операции.

Действительно, если вы внимательно посмотрите на фотографии звезды реалити-шоу, вы можете заметить различия во внешности, но вы не можете сделать 100% вывод о природе их происхождения.

  • Увеличение губ. Майя Донцова до этого из пластика выглядела довольно привлекательно, но по-деревенски. Губы не отличались объемом и сочностью, хотя девушка старалась подчеркнуть их насыщенными цветами помад.

На телевизоре, где идет негласная «гонка вооружений» с силиконом, ботоксом и имплантатами, трудно кого-то удивить увеличенными губами. Эта процедура давно перестала быть редкостью. Нельзя сказать, что Майя Донцова кардинально изменилась после пластической операции, но ее губы наполнились и приобрели дополнительный объем.

  • Ходят слухи, что участница делала блефаропластику, но нельзя с уверенностью сказать, что Майя Донцова снималась на ранних фотографиях до пластической операции. Глаза изменились, но, скорее всего, это следствие взросления участницы реалити-шоу и нынешнего яркого макияжа.

  • Пластиковые скулы. Если сравнить ранние и современные фотографии москвичей, то можно сделать вывод, что на них Майя Донцова до и после пластики скул.Однако это только на первый взгляд.

Девушка сильно похудела, это связано с фактом заострения скул. По словам специалистов, хирургического вмешательства не было.

  • Перспектива увеличения груди. Так получилось, что на лобном месте обсуждался вопрос об отсутствии груди у Майи. Поклонники поспорили, увидев, как изменилась Майя Донцова после пластической операции по увеличению бюста, но мама Ирина Михайловна высказалась против изменений.При этом известная блондинка сомневается, стоит ли ей следить за шутками публики по поводу маленького размера груди, или оставить все как есть.

Яркая блондинка любит плавать в лучах славы, для этого Майя может многое. Москвичка не гнушается ни мимолетными романами, ни драками с соперниками, ни даже драками и издевательствами собственной матери. Станет ли пластическая хирургия списком способов сохранить известность, покажет время.

Видео: Майя Донцова и Алексей Купин отвечают на вопросы зрителей

Девушка сняла у бизнесмена трехкомнатную квартиру в одном из лучших районов столицы.Отчим звезды «ДОМ-2» позаботился о том, чтобы ей было где жить, когда она уходила от телевизора.

Донцова Майя

Девушка с хорошим приданым - этот статус закрепила за участницей 25 лет. Журнал «ДОМ-2» решил посетить ту самую «трешку», существование которой обсуждают не только соседи по периметру, но и поклонники Майи. Охраняемая территория, 20-й этаж новостройки, 150 квадратных метров с панорамным видом на центр столицы, вокруг уютных парков с озерами и даже больница через дорогу - это место, где Майя будет жить после своего покидает проект.Оказалось, что шикарные апартаменты - это подарок отчима.

«Мы вместе занимались ювелирным бизнесом в Ростове, потом переехали в столицу, и долго он нас обеспечивал», - вспоминает Донцова-старшая. «Но перед отъездом на проект они решили разорвать отношения, и эта «трешка» - его прощальный подарок ».


Майя планирует переехать в шикарную квартиру после выхода из проекта

По словам женщины, она решила отдать ключи дочери.«Квартира еще не полностью отделана и не заселена мной», - делится Майя. «Я влюбился в нее за простор и не хочу ничего загромождать, единственное, чего здесь не хватает, так это лабрадора».

«Майя затащила всех в дом», - вспоминает мать участницы. «Котята, щенки, они жили с нами, царапали обои и мебель, а затем мы сопровождали их в лес, чтобы строить любовь».


Самостоятельная жизнь Майи началась уже в 18 лет.«Потом я полюбила и приехала вместе с молодым человеком», - говорит участница. - Пришлось научиться быть хозяйкой: готовить, стирать, убирать. Потом мы расстались, и я вернулась к маме, но ненадолго.

Итак, к 25 годам девушка сменила четыре места жительства. «Наконец, все эти три комнаты принадлежат только мне, у меня здесь есть все: просторная кухня для кулинарных шедевров, личный спортзал с беговой дорожкой, широкая кровать, огромный шкаф и место для вечеринок», - радуется Донцова-младшая.«Хорошо, что я живу вдали от мамы и бабушки, я бы не хотел, чтобы они превратились в надоедливых соседей».


По словам блондинки, делать интерьер помогла мама. «Мне нравится минимализм, поэтому все выполнено в одной цветовой гамме, я вообще думала выкрасить все стены в белый цвет, а пол выложить черной плиткой», - объясняет Майя. - Но мама настояла на том, что стоит сделать более теплые тона и украсить яркими вкраплениями в виде различных предметов декора.Поэтому можно заметить элементы ее любимого оранжевого цвета.

В ближайшее время Донцова планирует обновить ремонт в квартире. «В последнее время я, как и мой отец, увлеклась архитектурой, - признается Майя. «Я познакомился с творчеством папы и заметил, что нам нравится один стиль».

антибиотиков | Бесплатный полнотекстовый | Использование потенциально новых антибиотиков из актинобактерий мангровых зарослей в море Маовей путем сочетания нескольких стратегий открытия

1.Введение

Растущая распространенность устойчивых к антибиотикам бактерий, наряду с быстрым развитием перекрестной устойчивости с антибиотиками во всем мире, представляет собой одну из самых серьезных угроз общественному здоровью в 21 веке. Все классы антибиотиков стали свидетелями появления резистентности, затрудняющей их использование. Следовательно, срочно необходимы новые антибиотики для эффективной борьбы с устойчивыми к антибиотикам бактериями, особенно с патогенами ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa и Enterobacteriaceae) [1,2,3,4] .Усилия по открытию антибиотиков можно разделить на два направления с разным происхождением: натуральные продукты и синтетические антибактериальные препараты [5]. Несмотря на усилия по химическому синтезу, природная среда по-прежнему является ведущим источником открытия новых антибиотиков [6,7]. Что касается натуральных продуктов, то актинобактерии производят примерно две трети всех известных антибиотиков, большинство из которых вырабатываются стрептомицетами. Следовательно, эти микроорганизмы играют важную роль в борьбе с появляющимися патогенами с множественной лекарственной устойчивостью [8].Исторически сложилось так, что интенсивное изучение наземных актинобактерий привело к появлению многих важных лекарственных препаратов, которые позже были преобразованы в антибиотики, используемые в клинике (такие как стрептомицин, эритромицин и т. Д.). Между тем, частое повторное открытие известных антибиотиков стало проблемой, поскольку Ким Льюис упомянул, что «чем больше мы знаем об антибиотиках, тем меньше мы можем обнаружить» [9,10]. В настоящее время гораздо сложнее, чем раньше, открывать новые антибиотики, просто используя скрининг на основе актинобактерий [11,12].Таким образом, для решения этой проблемы задействовано множество новых стратегий и инновационных подходов, таких как использование новых антибиотиков из уникальных и малоизученных привычек, новые подходы к культивированию для выделения новых видов, которые, как считается, невозможно культивировать, новые модели скрининга, активация загадочного пути биосинтеза, анализ геномов [7,13,14,15,16,17,18] и использование современных аналитических методов в сочетании с мощными базами данных [19,20,21,22,23,24,25], поскольку считается, что актинобактерии являются до сих пор остается источником новых антибиотиков [26,27].Мангровые леса - одна из самых динамичных сред в мире - это уникальная экосистема, которая мало эксплуатируется актинобактериями. Водно-болотные угодья распространены в приливных эстуарных зонах тропических и субтропических регионов мира и представляют собой богатое биологическое разнообразие растений, животных и микроорганизмов [28,29,30]. Элементы окружающей среды мангровых зарослей, такие как географическое положение, pH, температура, соленость, влажность и питательные вещества, значительно различаются в разных регионах, поэтому актиномицеты мангровых лесов разнообразны и уникальны [31].В последнее десятилетие исследования актиномицетов мангровых растений и их вторичных метаболитов стали горячей точкой для открытия новых антибиотиков. На сегодняшний день из мангровых зарослей выделено по меньшей мере 88 новых видов актинобактерий, в том числе восемь новых родов, и зарегистрировано более 80 новых соединений, включая некоторые многообещающие молекулы, такие как салиноспорамид A, галихоблелид D, ксиамицины и индолокарбазолы, полученные из мангровых зарослей. актинобактерии [27,32,33,34,35,36,37,38].

В этом исследовании мы стремились изучить разнообразие, антибактериальную активность и потенциал для производства новых биоактивных вторичных метаболитов культивируемых актиномицетов, выделенных из мангрового заповедника моря Маовей, относительно неизведанного региона в городе Циньчжоу, Гуанси-Чжуанский автономный район, Китай.Для отбора актиномицетов использовали культурозависимые подходы с использованием различных сред. Их способность проявлять антимикробную активность против возбудителей «ESKAPE» оценивали методом дисковой диффузии. Между тем, модель высокопроизводительного скрининга, основанная на двойном флуоресцентном белке-репортере, также была реализована для обнаружения штаммов, продуцирующих вторичные метаболиты в качестве ингибиторов биосинтеза рибосом и / или ДНК. Наконец, вторичные метаболиты Streptomyces sp. Приоритет B475 был отдан анализу с использованием комплексных подходов, включая фракционирование под контролем биопроб, метод расстановки дефисов, идентификацию в базе данных и молекулярно-сетевой анализ на основе MS / MS.

3. Обсуждение

Актинобактерии широко распространены в мангровых зарослях [34,37,38,41,42,43,44,45,46]. В этом исследовании, чтобы изучить биоразнообразие актинобактерий и собрать больше потенциально антибактериальных штаммов, было собрано восемь образцов мангровой почвы из различных участков заповедника мангровых зарослей моря Маовей. Всего из восьми различных сред был выделен 261 штамм актинобактерий 19 родов из 10 семейств 6 порядков. Результаты не только продемонстрировали богатое разнообразие актинобактерий в заповеднике Maowei Sea Mangrove Reserve, но также предоставили для анализа множество штаммов различных родов, включая редких актиномицетов.Так называемые патогены «ESKAPE» были первоначально изобретены Американским обществом инфекционных болезней (IDSA), чтобы подчеркнуть их способность «ускользать» от обычного антибактериального лечения. Таким образом, этой группе устойчивых к лекарствам патогенных бактерий уделяется наибольшее внимание в программах открытия и скрининга лекарств [3,47]. В этом исследовании 12 штаммов, включая лекарственно-чувствительные и устойчивые к лекарствам возбудители «ESKAPE», были использованы в качестве индикаторных штаммов. Из 83 выбранных штаммов 12 штаммов обладали сильной ингибирующей активностью (зона ингибирования> 20 мм) в отношении грамположительных бактерий.Эта группа из 12 штаммов включала семь штаммов Streptomyces (B486, B290, B448, B475, B390, B353, B98), четыре штамма Micromonospora (B42, B331, B409, B277) и один штамм Nocardia (B391). Среди них штамм B42 также продемонстрировал сильную ингибирующую активность против грамотрицательных бактерий, таких как лекарственно-чувствительные и лекарственно-устойчивые E. Coli и лекарственно-чувствительные K. pneumonia. Однако, за исключением штамма B42, ни один из других 82 штаммов не проявил сильной ингибирующей активности против грамотрицательных штаммов. Чтобы ускорить открытие антибиотиков и раннее выявить потенциальный антибактериальный механизм 83 выбранных штаммов, используется система двойного флуоресцентного белка-репортера (pDualrep2). [48] ​​был реализован.Клетка E. coil, трансформированная плазмидой pDualrep2, представляет собой сенсор ингибиторов трансляции, за которым можно следить по индукции экспрессии Katushka2S, и повреждающих ДНК агентов, контролируемых по индукции экспрессии RFP. Типичный ингибитор трансляции эритромицин может индуцировать экспрессию Katushka2S, тогда как левофлоксацин, ингибитор топоизомеразы, вызывает экспрессию RFP. В этом исследовании экспрессия Katushka2S могла быть индуцирована штаммом Streptomyces B441 и штаммом Micromonospora B704. Экспрессия RFP может быть индуцирована четырьмя штаммами Streptomyces, включая штамм B475, B486, B353 и B98.

Всесторонний анализ двух групп данных биоанализа, четыре штамма Streptomyces (B475, B486, B353 и B98) показали положительные результаты одновременно в антибактериальном анализе и анализе pDualrep2. Он показал, что они являются потенциальными кандидатами на применение новых антибиотиков и заслуживают дальнейшего изучения их биологически активных вторичных метаболических профилей. Из четырех штаммов Streptomyces B475 был выбран в качестве примера для исследования его вторичных метаболитов в первую очередь.

Дерепликация имеет решающее значение для быстрого открытия новых натуральных продуктов в экстрактах бульонов микробной ферментации [49].Большое количество вторичных метаболитов Streptomyces spp. уже известны [7]. Следовательно, необходимо приложить усилия для быстрой и ранней дерепликации неочищенного экстракта штамма Streptomyces B475. После анализа UPLC-UV-HRESIMS / MS с базой данных Chemspider и сравнения характеристических УФ-спектров с литературными данными основным биоактивным компонентом Streptomyces B475 был идентифицирован эхиномицин. Результат соответствует результату скрининга неочищенного экстракта B475 на системе двойного флуоресцентного белка-репортера, поскольку эхиномицин широко известен как первый бисинтеркалятор ДНК [50,51] и определенно может активировать SOS-ответ для индукции экспрессии RFP. в pDualrep2.Эхиномицин представляет собой циклический октапептид, который принадлежит к семейству хиноксалинов, группе антибиотиков, содержащих хиноксалиновое кольцо [39,51]. Эхиномицин проявил много интересных биоактивностей [52,53,54], но потерпел неудачу в испытаниях фазы II по лечению рака из-за его минимальной активности in vivo против нескольких опухолей [55]. Недавно исследования переориентировались на его значительную активность против грамположительных бактерий. Бактерицидный анализ in vitro показал, что эхиномицин проявляет сильную активность против нескольких клинических изолятов устойчивых к ванкомицину энтерококков (VRE), что позволяет предположить, что он может быть полезен в качестве препаратов против VRE [56].Исследования его антистафилококковой активности in vitro и in vivo показали, что активность эхиномицина против S. aureus, включая MRSA, была, по крайней мере, эквивалентна активности ванкомицина [57]. Кроме того, другое исследование показало, что эхиномицин обладает сильной ингибирующей активностью in vitro против лекарственно-устойчивых и образующих биопленки S. aureus и Enterococcus faecalis (E. faecalis) [58]. Все эти антибактериальные свойства против грамположительных бактерий привлекли многих исследователей к синтезу новых аналогов эхиномицина [59,60] и открытию новых членов хиноксалина.Насколько нам известно, по меньшей мере 37 членов семейства хиноксалинов были выделены из различных штаммов актинобактерий (Таблица S5). Чтобы открыть больше новых аналогов эхиномицина в культуральном бульоне штамма B475, веб-платформа Global Natural Products Была задействована социальная молекулярная сеть (GNPS; http://gnps.ucsd.edu) [22]. В нескольких исследованиях сообщалось об успешном применении его для эффективной химической дерепликации и открытия новых метаболитов [20,21,61,62,63]. В этом исследовании в экстракте Streptomyces B475 были обнаружены два кластера (кластер A и B), относящиеся к хиноксалиновым антибиотикам.Вероятно, присутствие двух различных химических модификаций привело к более чем одному различию в паттернах фрагментации MS / MS между кластерами A и B, предполагая, что соединения кластеров A и B, вероятно, принадлежат к разным подгруппам. Ограничение молекулярной сети не позволяло выровнять спектры молекул, которые отличаются двумя различными структурными модификациями, согласно веб-документации GNPS [64]. Кроме того, продолжается дальнейшая очистка и структурное выяснение пяти новых предполагаемых аналогов хиноксалинов.

4. Материалы и методы

4.1. Сбор образца мангровой почвы
Восемь образцов мангровой почвы были собраны в заповеднике мангровых зарослей Маовей, город Циньчжоу, Гуанси-Чжуанский автономный район, Китай, в июле 2017 года (рис. 9). Информация об образцах приведена в Таблице S6. Все образцы были упакованы в стерилизованные конверты и доставлены в лабораторию в кратчайшие сроки. Каждый образец немедленно сушили на воздухе в вытяжном шкафу с ламинарным потоком перед измельчением в ступке и пестиком.
4.2. Выделение и поддержание актинобактерий
Были приготовлены восемь питательных сред для выделения штаммов актинобактерий (таблица S1). В питательные среды добавляли налидиксовую кислоту (20 мг / л), циклогексимид (50 мг / л) и дихромат калия (50 мг / л) для подавления роста грамотрицательных бактерий и грибов. Актинобактерии выделяли с помощью разбавления. метод нанесения покрытия, как описано Li et al. [38]. Объем 0,2 мл почвенной суспензии 10 –2 (г / мл) наносили на чашки с изолирующим агаром.После инкубации при 28 ° C в течение 2–4 недель одну колонию собирали и наносили штрихами на свежеприготовленную среду ISP 2 (Difco, Becton, Dickinson and Company, Sparks, Мэриленд, США) для получения чистых изолятов. Чистые культуры поддерживали на скошенных агарах ISP 2 при 4 ° C, а также хранили в суспензиях глицерина (20% об. / Об.) При -80 ° C.
4.3. ПЦР-амплификация и секвенирование гена 16S рРНК
Геномную ДНК экстрагировали из чистых изолятов, как описано Zhou et al. [65] и использовали в качестве матрицы для амплификации гена 16S рРНК с помощью ПЦР с универсальными праймерами 27F (5ʹ-AGAGTTTGATCMTGGCTCAG-3ʹ) и 1492R (5ʹ-GGTTACCTTGTTACGACTT-3ʹ).Реакционная смесь (50 мкл) содержала 25 мкл 2 × супермикса (TransGen Biotech, Пекин, Китай), по 1 мкл каждого из праймеров (10 мМ, Sangon Biotech, Шанхай, Китай), 1,5 мкл ДНК и 21,5 мкл ddH 2. O. ПЦР-амплификация включала следующие параметры: (i) 95 ° C в течение 3 минут (начальная денатурация), (ii) 30 циклов при 94 ° C в течение 1 минуты (денатурация), 60 ° C в течение 1 минуты (отжиг) , 72 ° C в течение 1 мин (удлинение) и (iii) 72 ° C в течение 10 мин (окончательное удлинение). Затем ампликоны визуализировали гель-электрофорезом с использованием 5 мкл продукта ПЦР в 1% агарозном геле.Продукты ПЦР очищали и затем секвенировали на анализаторе ДНК ABI PRISM TM 3730XL (Thermo Fisher Scientific, Уолтем, Массачусетс, США).
4.4. Анализ последовательностей
Полученные последовательности гена 16S рРНК сравнивали с последовательностями из типовых штаммов, доступных в GenBank NCBI (http://www.ncbi.nlm.nih.gov/) и в базе данных EzBioCloud (https: //www.ezbiocloud. net /) [66] с помощью инструмента Basic Local Alignment Search Tool (BLAST) [67] для поиска последовательности ближайшего соответствия. Соответствующие последовательности близкородственных типовых видов были получены из базы данных GenBank с помощью сервера EzBioCloud.Множественные выравнивания были выполнены с помощью инструмента Clustal_X в MEGA версии 7.0 [68,69]. Филогенетическое дерево, основанное на методе объединения соседей [70], было построено в рамках двухпараметрической модели Кимуры [71], а бутстрап-анализ с 1000 повторениями [72] был выполнен с помощью MEGA версии 7.0.
4.5. Номера нуклеотидных последовательностей:

Последовательности рРНК 16S выделенных штаммов были депонированы в GenBank под номерами доступа: MN199467-MN199548 и MN204487.

4.6. Скрининг антибактериальной активности

На основании анализа фенотипических и филогенетических характеристик было отобрано только 83 штамма для изучения их антибактериального потенциала. Каждый штамм переносили в колбы Эрленмейера на 500 мл, содержащие 100 мл среды ISP 2, и культивировали в течение 7 дней при 28 ° C со встряхиванием со скоростью 180 об / мин. 300 мл (3 × 100 мл) ферментационного бульона, полученного из каждого изолятов, центрифугировали при 4500 об / мин в течение 20 минут для отделения части мицелия. Супернатанты дважды экстрагировали этилацетатом (1: 1, об. / Об.).Органический слой сушили на роторном испарителе и остаток растворяли в 3 мл метанола. Часть мицелия вымачивали в ацетоне на ночь, а затем фильтровали. Фильтрат концентрировали под вакуумом и растворяли в 3 мл смеси 50% метанол-вода (1: 1, об. / Об.). Наконец, каждый штамм дал два вида образцов для антибактериального анализа методом дисковой диффузии. Образец метанола (60 мкл) капали на бумажный диск (диаметр 6 мм). Кроме того, в качестве отрицательного контроля использовали 60 мкл метанола и раствор левофлоксацина (10 мкл, 0.1 мг / мл) использовали в качестве положительного контроля. После сушки в кожухе биобезопасности бумажные диски переносили на чашки с агаром, содержащим патогенные бактерии, и инкубировали при 37 ° C в течение 24 часов. Наконец, антибактериальную активность оценивали путем измерения диаметров зоны ингибирования штангенциркулем Вернье. Индикаторные бактерии, использованные для антимикробного анализа, представляли собой шесть наборов бактерий «ESKAPE», включая Enterococcus faecalis (ATCC 33186 и 310682), Staphylococcus aureus (ATCC 29213 и ATCC 33591), Klebsiella pneumonia (ATCC 10031 и ATCC 700603), Acinetobacter baumannii (27 ATCC 19606), Pseudomonas aeruginosa (ATCC 27853 и 2774) и Escherichia coli (ATCC 25922 и ATCC 35218), каждый набор состоял из двух штаммов, один был чувствительным штаммом (первый), а другой - устойчивым к лекарствам штаммом (последний). .Изолят 310682 был устойчив к ванкомицину; Между тем изолят 2774 был устойчив к аминогликозидам и карбапенемам. Бактерии-индикаторы были получены из Американской коллекции типовых культур (АТСС) или в клинике и депонированы в Институте медицинской биотехнологии Китайской академии медицинских наук и Пекинском медицинском колледже.

4.7. Определение механизма действия
Ингибиторы биосинтеза рибосом и ДНК были проверены двойной флуоресцентной белковой репортерной системой с репортерным штаммом JW5503-pDualrep2 [48].Вкратце, 100 мкл этилацетатного экстракта сушили и добавляли 100 мкл ДМСО в качестве исследуемого образца. Объем 2 мкл образца наносили на чашку с агаром, содержащую лужайку репортерного штамма. После инкубации в течение ночи при 37 ° C планшет сканировали с помощью системы ChemiDoc Imaging System (Bio-Rad Laboratories, США) с двумя каналами: «Cy3-blot» (553/574 нм, зеленый псевдоцвет) для флуоресценции RFP и «Cy5-blot. ”(588/633 нм, красный псевдоцвет) для флуоресценции Катушки2С. Индукция экспрессии Katushka2S запускается ингибиторами трансляции, тогда как RFP активируется за счет индукции SOS-ответа на повреждение ДНК.Левофлоксацин и эритромицин использовали в качестве положительного контроля для биосинтеза ДНК и ингибиторов рибосом соответственно.
4.8. Идентификация биоактивных полос с помощью тонкослойной хроматографии (ТСХ)

После центрифугирования при 3000 об / мин в течение 5 минут 200 мкл неочищенного экстракта EA штамма B475 загружали в виде полосы длиной 80 мм на предварительно покрытый силикагель размером 20 см × 10 см 60 F 254 Планшет для ТСХ (Merck KGaA, Дармштадт, Германия) в потоке азота с использованием полуавтоматического аппликатора образцов CAMAG Linomat 5, снабженного шприцем Hamilton на 500 мкл.Планшет проявляли до 190 мм с помощью 20 мл дихлорметана: метанола = 10: 1 (об. / Об.) В качестве подвижной фазы в камере с двумя желобами CAMAG размером 20 см × 20 см, предварительно насыщенной в течение 15 мин. После проявления пластина вынималась из камеры и сушилась на воздухе. Изображения разделенных полос были сняты и помечены карандашом при УФ 254 нм под CAMAG TLC Visualizer 2. Наконец, одна треть силикагеля каждой полосы была соскребана соответственно, а затем накоплена на пластинах с агаром, содержащим метициллин- устойчивый золотистый стафилококк ATCC 33591 в шкафу биобезопасности.Планшеты инкубировали при 37 ° C в течение 24 ч, диаметр зон ингибирования полос измеряли штангенциркулем Вернье.

4.9. Идентификация биоактивных пиков с помощью высокоэффективной жидкостной хроматографии (ВЭЖХ)

Оставшийся силикагель биоактивной полосы соскребали с пластинки для ТСХ и затем элюировали 20 мл ацетона. Элюат ацетона сушили в вакууме, а остатки растворяли в 0,5 мл метанола для ВЭЖХ. После центрифугирования при 12000 об / мин в течение 5 минут 200 мкл метанольного раствора подвергали ВЭЖХ (Shimadzu LC-20AT), снабженной колонкой Agilent ZORBAX SB-C18 (9.4 × 250 мм, 5 мкм). Подвижная фаза - раствор ацетонитрил-вода при скорости потока 2 мл / мин методом градиентного элюирования: 10% -ный ацетонитрил в течение 0–5 мин; От 10% до 70% ацетонитрила в течение 5–45 мин; От 70% до 90% ацетонитрила в течение 45–55 мин; 90% ацетонитрил в течение 55–60 мин. Используемая длина волны обнаружения составляла 215 нм. Для идентификации биоактивных пиков фракцию собирали за минуту и ​​получали 58 фракций (0–3 мин как фракция 1). Все фракции сушили под вакуумом и растворяли в 50 мкл метанола.Двадцать микролитров каждой фракции подвергали скринингу против метициллин-устойчивого Staphylococcus aureus ATCC 33591 методом дисковой диффузии. После инкубирования при 37 ° C в течение 24 ч диаметры зон ингибирования полос измеряли штангенциркулем Вернье.

4.10. Дерепликация и анализ молекулярной сети микробных экстрактов

Три микролитра образцов из штамма B475, включая неочищенный экстракт EA, активную полосу из ТСХ и активные пики из ВЭЖХ, анализировали с помощью UPLC-HRESIMS / MS (Waters Xevo G2- XS QTof) с колонкой ACQUITY UPLC BEH C18 (2.1 × 100 мм, 1,7 мкм). Колонку элюировали градиентной подвижной фазой раствора ацетонитрил-вода при скорости потока 0,3 мл / мин: 10% ацетонитрила в течение 2 минут, от 10% до 70% ацетонитрила в течение следующих 28 минут, затем от 70% до 90% ацетонитрила для 5 мин, наконец, 90% ацетонитрил в течение 3 мин. Детектор КПК был установлен между 194 и 400 нм. Рабочие параметры источника были определены следующим образом: капиллярное и конусное напряжение были установлены на 2,0 кВ и 40 В, температура десольватации и температура источника были установлены на 260 ° C и 100 ° C, соответственно.В качестве небулайзера и вспомогательного газа использовался азот высокой чистоты. Скорость потока конусного газа составляла 50 л / ч, а расход газа для десольватации поддерживался на уровне 600 л / ч. В качестве газа столкновений использовался аргон. Точность определения массы поддерживалась с помощью спрея-фиксатора с лейцин-энкефалином (в режиме положительных ионов [M + H] + = 556,2771 Да) при концентрации 200 пг / мл и скорости потока 10 мкл / мин в качестве эталона. Было получено

методов MS в режиме сбора данных независимо от данных (MS E ) для анализа UNIFI и сбора данных, зависимого от данных (DDA), для анализа GNPS, соответственно.MS E была проведена путем работы прибора в режиме положительных ионов, применения функций МС и МС / МС с 6 В низкой энергией и 20–45 В высокой энергией, чтобы собрать отношение массы к заряду (m / z) из От 100 до 1500 Да. Программное обеспечение MassLynx V4.1 использовалось для сбора данных, а программное обеспечение UNIFI использовалось для обработки данных и удаления репликации путем поиска предсказанной точной массы по Chemspider (http://www.chemspider.com/). DDA проводился в режиме положительных ионов, полное сканирование MS-обзора выполнялось для 0.1 с в диапазоне 100–1600 Да, в то время как МС / МС сканировали в диапазоне масс 50–1600 Да за то же время. Восемь наиболее интенсивных ионов дополнительно сканировали на предмет спектров фрагментации МС / МС. Градиент энергии столкновения был установлен от 6 до 9 В для LM CE (энергия столкновения малой массы) и от 80 до 90 В для HM CE (энергия столкновения большой массы). Автоматическое переключение в режим МС / МС было включено, когда интенсивность TIC превысила 10 000 отсчетов, и отключалось, когда прошло 0,2 с, или интенсивность TIC составила 1000 отсчетов.Окно допуска ± 3,0 Да было установлено в режиме детектирования пиков деизотопов. Динамическое исключение пиков было включено, зарегистрировано и затем исключено на 0,2 с. Файлы необработанных данных, полученные в результате сбора данных DDA, были преобразованы в 32-битный формат mzML с помощью MS-Convert [73], а затем загружены на веб-платформу GNPS для дерепликации и построения молекулярных сетей. Молекулярная сеть MS / MS была создана с использованием рабочего процесса GNPS «Classic» молекулярных сетей (METABOLOMICS-SNETS-V2), в котором был активирован MS-Cluster.Параметры для генерации молекулярной сети были установлены следующим образом: допуск по массе предшественника m / z 0,02 Да, толерантность по ионам фрагментов MS / MS m / z 0,04 Да, минимальный косинусный балл 0,65, минимальное количество согласованных ионов фрагментов 4, минимальный размер кластера 2, сеть TopK 10 ; сопоставление спектральной библиотеки выполнялось с той же минимальной косинусной оценкой и шестью согласованными параметрами фильтра числа ионов фрагментов. Сгенерированная молекулярная сеть была визуализирована с помощью Cytoscape 3.7.1 [74] и произведен поиск кластеров данных m / z, которые проясняют соединения, образующие кластеры.
4.11. Накопление и измерение пика 3

Оставшийся экстракт EA штамма B475 подвергали ТСХ, как показано выше (Материалы и методы 4.8), и дополнительно очищали с помощью ВЭЖХ, как указано выше (Материалы и методы 4.9). Наконец, биоактивные фракции при R t = 45–46 мин были объединены и сконцентрированы роторным испарением в вакууме с получением пика 3 (0,7 мг). Пик 3 растворяли в CDCl 3 и измеряли с помощью прибора Varian VNS-600 ЯМР при 600 МГц с ТМС в качестве внутреннего стандарта для получения спектра ЯМР 1 H.

(PDF) Методы скрининга ингибиторов трансляции

Antibiotics 2016,5, 22 11 из 11

14.

VanBogelen, R.A .; Neidhardt, F.C. Рибосомы как сенсоры теплового и холодового шока у Escherichia coli // Тр. Natl.

Акад. Sci. USA 1990, 87, 5589–5593. [CrossRef] [PubMed]

15. Goldstein, J .; Pollitt, N.S .; Inouye, M. Главный белок холодового шока Escherichia coli. Proc. Natl. Акад. Sci. США

1990,87, 283–287. [CrossRef] [PubMed]

16.

Weisblum, B. Понимание действия эритромицина на основе исследований его активности как индуктора устойчивости.

Антимикробный. Агенты Chemother. 1995, 39, 797–805. [CrossRef] [PubMed]

17.

Поликанов Ю.С.; Osterman, I.A .; Szal, T .; Ташлицкий, В.Н .; Серебрякова, М.В .; Кусочек, П .; Bulkley, D .;

Маланичева И.А .; Ефименко, Т.А .; Ефременкова, О.В .; и другие. Амикумацин ингибирует трансляцию, стабилизируя взаимодействие

и

мРНК с рибосомой.Мол. Cell 2014,56, 531–540. [CrossRef] [PubMed]

18.

Goh, E.B .; Yim, G .; Tsui, W .; McClure, J .; Surette, M.G .; Дэвис, Дж. Транскрипционная модуляция экспрессии бактериального гена

с помощью субингибирующих концентраций антибиотиков. Proc. Natl. Акад. Sci. США

2002

, 99, 17025–17030.

[CrossRef] [PubMed]

19.

Светлов М.С .; Коммерс, А .; Кольб, В.А .; Спирин, А. Эффективный котрансляционный фолдинг люциферазы светлячков без

шаперонов семейства Hsp70.Protein Sci. Publ. Protein Soc. 2006, 15, 242–247. [CrossRef] [PubMed]

20.

Shimizu, Y .; Иноуэ, А .; Tomari, Y .; Сузуки, Т .; Yokogawa, T .; Nishikawa, K .; Ueda, T. Бесклеточная трансляция

, восстановленная очищенными компонентами. Nat. Biotechnol. 2001, 19, 751–755. [CrossRef] [PubMed]

21.

Lowell, A.N .; Santoro, N .; Swaney, S.M .; McQuade, T.J .; Schultz, P.J .; Larsen, M.J .; Sherman, D.H. Microscale

адаптация

in vitro

транскрипция / трансляция для высокопроизводительного скрининга экстрактов натуральных продуктов

библиотеки.Chem. Биол. Drug Des. 2015, 86, 1331–1338. [CrossRef] [PubMed]

22.

Orelle, C .; Карлсон, С .; Kaushal, B .; Almutairi, M.M .; Liu, H .; Ochabowicz, A .; Quan, S .; Pham, V.C .;

Squires, C.L .; Мерфи, Б.Т .; и другие. Инструменты для характеристики ингибиторов синтеза бактериального белка.

Антимикробный. Агенты Chemother. 2013,57, 5994–6004. [CrossRef] [PubMed]

23.

Polacek, N .; Swaney, S .; Shinabarger, D .; Манкин, А. Spark - новый метод мониторинга активности рибосомальной пептидил

трансферазы.Биохимия 2002,41, 11602–11610. [CrossRef] [PubMed]

24.

Llano-Sotelo, B .; Hickerson, R.P .; Lancaster, L .; Noller, H.F .; Манкин, А. Флуоресцентно помеченные рибосомы как

инструмент для анализа связывания антибиотиков. РНК 2009,15, 1597–1604. [CrossRef] [PubMed]

25.

Николай, Р .; Schloemer, R .; Schmidt, S .; Мюллер, С .; Heubach, A .; Deuerling, E. Подтверждение концепции скрининга на основе флуоресценции

для выявления дефектов сборки рибосом в Escherichia coli.

Nucleic Acids Res. 2014,42, e100. [CrossRef] [PubMed]

26.

Holtkamp, ​​W .; Cunha, C.E .; Peske, F .; Коневега, А.Л .; Wintermeyer, W .; Роднина, М. Гидролиз GTP с помощью

EF-G синхронизирует движение тРНК на малых и больших субъединицах рибосом. EMBO J.

2014

, 33, 1073–1085.

[CrossRef] [PubMed]

27.

Weber, C.C .; Link, N .; Fux, C .; Zisch, A.H .; Weber, W .; Фуссенеггер, М. Белковые биосенсоры широкого спектра действия

для определения антибиотиков в зависимости от класса.Biotechnol. Bioeng. 2005, 89, 9–17. [CrossRef] [PubMed]

28.

Nonejuie, P .; Burkart, M .; Pogliano, K .; Pogliano, J. Бактериальный цитологический анализ быстро идентифицирует

клеточных путей, на которые нацелены антибактериальные молекулы. Proc. Natl. Акад. Sci. США

2013

, 110, 16169–16174.

[CrossRef] [PubMed]

29.

Wenzel, M .; Бандоу, Дж. Э. Протеомные сигнатуры в исследованиях антибиотиков. Протеомика

2011

, 11, 3256–3268.

[CrossRef] [PubMed]

30.

Bandow, J.E .; Brotz, H .; Leichert, L.I .; Labischinski, H .; Хеккер, М. Протеомный подход к пониманию действия антибиотиков

. Противомикробный. Агенты Chemother. 2003, 47, 948–955. [CrossRef] [PubMed]

31.

Kannan, K .; Vazquez-Laslop, N .; Манкин, А. Селективный синтез белка рибосомами с выходным туннелем

, затрудненным лекарствами. Cell 2012,151, 508–520. [CrossRef] [PubMed]

32.

Остерман, И.А .; Устинов, А.В .; Евдокимов, Д.В .; Коршун, В.А .; Сергиев, П.В .; Серебрякова, М.В .; Демина, И.А .;

Галямина, М.А .; Говорун, В.М .; Донцова, О.А. Возникающее протеомное исследование, объединяющее щелочную химию с

2DE. Протеомика 2013, 13, 17–21. [CrossRef] [PubMed]

33. Athamneh, A.I .; Alajlouni, R.A .; Wallace, R.S .; Seleem, M.N .; Зенгер, Р. Фенотипическое профилирование сигнатур ответа на антибиотик

в Escherichia coli с использованием рамановской спектроскопии. Противомикробный. Агенты Chemother.

2014

, 58,

1302–1314. [CrossRef] [PubMed]

©

2016 авторами; лицензиат MDPI, Базель, Швейцария. Эта статья представляет собой статью

в открытом доступе, распространяемую в соответствии с условиями лицензии Creative Commons Attribution

(CC-BY) (http://creativecommons.org/licenses/by/4.0/).

Бывшая жена актера «Легенды № 17» стала участницей «Дома-2» - Celebrity News

Финалистка проекта «Хочу в ВИА гра» Юлия Ефременкова решила завязать роман с бойкой Жемчуговой.Появление актрисы на реалити-шоу стало предметом активных обсуждений в социальных сетях. По словам Юлии, участие в проекте подарило ей много новых эмоций.

Недавно в «Доме-2» появился новый участник. На телестройку пришла артистка Юлия Ефременкова. Девушка заявила, что хочет построить отношения с Глебом Жемчуговой. Однако не исключено, что Юлия надеется напрасно, и сердце объекта ее страсти наполнилось. Недавно Глеб заинтриговал поклонников фото загадочной девушки, которую зовут Евгения Шатунова.«Я рад, что ты так внезапно появился в моей жизни», - поделился он в соцсетях. О загадочной девушке Жемчуговой известно, что она родом из Кирово-Чепецка, а сейчас проживает в Москве. Сам Евгений пока не высказывался на тему отношений со звездным проектом канала ТНТ.

Появление Юлии Ефременковой вызвало бурю эмоций у телезрителей. Вспомнили, что девушка участвовала в проекте «Хочу в ВИА гра» и даже стала финалисткой. Потом поддержала ее мужа Тимура Ефременкова, известного по ролям в таких фильмах и телесериалах, как «Легенда №17», «Папины дочки», «След» и «Глухарь».Пользователи соцсетей были удивлены, увидев, что Юля действительно пошла на телестройку после ссоры с мужем? Они начали обсуждать якобы измену артистки и попросили у нее объяснений по поводу случившегося. Юлия предпочла не отвечать на вопросы фолловеров. Вместо этого она опубликовала фотографии, сделанные на съемках «Дома-2».

«Просто выпал из мира… Новые эмоции и хорошее испытание нервной системы», - поделился артист в Instagram, комментируя свое пребывание на телестройке.

Позже выяснилось, что Юлия - свободная женщина. Она рассталась с Тимуром в июле этого года и сохранила фамилию супруга. В одном из своих интервью актер заявил, что хорошие отношения с бывшей возлюбленной, несмотря на развод. Тимур и Юлия были вместе восемь лет, из них четыре года были в браке.

Leave a Reply

Ваш адрес email не будет опубликован. Обязательные поля помечены *