Донцова ирина: Ирина Михайловна Донцова Дом 2

Содержание

Ирина Михайловна Донцова Дом 2

Дата рождения: 9 Января 1972 года

Возраст: 49 лет

Город: Москва

Пришла на проект 29 Сентября 2016 года

  • Думаю, телезрители ещё не забыли маму Майи-Ирину Донцову. Какое-то время она находилась на проекте в качестве участницы и «помогала» дочери строить отношения на Дом-2.
    Ну, как помогала, помню, что был… 07.07.2020
  • И все же не напрасно Александра Черно на днях закатила в студии шоу «Бородина против Бузовой» грандиозную истерику, требуя, чтобы ей хотя бы на последних сроках беременности… 09.06.2020
  • Вот уже много лет на телепроекте Дом-2 живут две пары участников. В прошлом году Купины и Капаклы сыграли свадьбы и стали официальными мужьями и жёнами. Несмотря на то, что Рома и Марина не хотели свадьбу… 20.
    04.2020
  • В последнее время довольно часто в эфирах Дом-2 можно наблюдать родителей участников. Организаторы телешоу всеми силами тянут на телешоу родственников, чтобы они помогали своим взрослым детям разбираться… 17.04.2020
  • В сети ни в первый раз поднимаются слухи о грядущих переменах на доме 2. Неоднократно фолловеры обсуждали возможность переезда реалити-шоу на новую площадку. Впрочем, организаторы подготовили для зрителей… 15.
    12.2019
  • На съёмки новогоднего выпуска «Бородина против Бузовой» в студии собрались проектные мамочки: мама Лизы Триандафилиди, Наталья Купина, Ирина Донцова, Татьяна Африкантова с мужем, Ольга Васильевна Гобозова… 14.12.2019
  • Кто бы мог подумать, что к началу конкурса «Свадьба на миллион» именно Майя Донцова и Алексей Купин станут теми, кто на фоне остальных конкурсантов будут выглядеть самыми достойными и честными… 20.
    03.2019
  • Что бы делали редакторы, если бы на Острове любви не было Милены Безбородовой и Алексея Безуса, которые готовы скандалить сутками напролет, не давая своим соседям спокойно спать… 05.03.2019
  • Осталось еще несколько дней до того самого эфира, как мы увидим грандиозную драку Александры Черно и Либерж Кпадону. И что-то подсказывает, что те ролики, которые сделали ребята…. 05.02.2019
  • Алиана Устиненко неожиданно для всех покинула проект, сославшись на то, что очень скучает по Роберту, поэтому Роза Максимова осталась в полном одиночестве против пары Алексея Купина и Майи Донцовой. .. 12.01.2019
  • На днях Ирина Михайловна Донцова имела неосторожность неудачно похвастаться перед подписчиками. Женщина сообщила, что решила немного похудеть, чтобы на Сейшелах, на свадьбы Майи и Алеши выглядеть красиво… 17.12.2018
  • Еще за несколько дней до поражения в полуфинале Алексей Купин с большой гордостью рассказывал о том, что его мама и мама Майи очень подружились и частенько проводят время вместе. .. 15.12.2018
  • Еще совсем недавно мамы Алексея Купина и Майи Донцовой за периметром не особенно плотно общались, а сегдня они почти не разлей вода. Что ни день, то новые посты о том, как здорово и весело дамочкам вдвоем… 05.11.2018
  • Как и следовало ожидать, новость о предстоящей свадьбе Иосифа Оганесяна и Александры Черно не особо обрадовала Майю Донцову, которая очень хотела выйти замуж в этом году и устроить пышное торжество.
    .. 26.10.2018
  • Сейчас на проекте разбирается тема интимных проблем в паре Майи Донцовой и Алексея Купина. Участники и ведущие считают, что у ребят большие проблемы в отношениях, поскольку они… 25.10.2018
  • До недавнего времени в паре Майи Донцовой и Алексея Купина царили гармония, взаимопонимание и любовь. Влюбленные практически перестали выяснять отношения и целенаправленно готовились к свадьбе… 18.
    10.2018
  • Алексей Купин жениться явно не хочет. Не знаю, как вы, а я согласна с теми, кто выдвинул эту версию. Похоже, идею с браком и кольцом для Майи Донцовой он и в самом деле придумал для захода на проект.… 30.08.2018
  • В сети давно ходят слухи о том, что Саймон Марданшин уже сменил гнев на милость и готов возобновить сотрудничество с телестройкой. А ведь еще пару месяцев назад он уверял подписчиков в том, что… 28.
    08.2018
  • Зрители удивляются, как Майя Донцова и Алексей Купин умудряются попадать в эфиры с одной и той же темой второй год подряд. Все уже устали от того, что Ирина Михайловна не дает жизни… 23.08.2018
  • Ирина Михайловна Донцова снова зачастила в периметр. Впрочем, и на этот раз миссия женщины, по мнению зрителей, не вполне понятна. Сама она говорит, что хочет помочь дочери, а на деле опять мешает… 16.
    08.2018

Ирина Михайловна Донцова Дом 2 — Читайте последние новости!

Читайте последние новости — Ирина Михайловна Донцова Дом 2 на сегодня. Ирина Михайловна Донцова свежие слухи и сплетни из Дома 2.

Ирина Викторовна Донцова

Дата рождения: 12.08.1964 г.

Старший тренер-преподаватель по прыжкам в воду МБУДО КСДЮСШОР № 10 «Олимп».

Квалификационная категория: высшая.

Стаж работы по специальности: 30 лет.

Известные воспитанники:

Александр Кандрашин – мастер спорта России по прыжкам в воду, призёр первенства Европы, победитель первенства России, серебряный призёр Кубка России 2010 и 2013 гг., финалист Спартакиады молодёжи России 2010 года, бронзовый призер чемпионата России 2011 года, чемпион России в синхронных прыжках 2012 года, бронзовый призер Чемпионата России-2014 г. ; серебряный призер в командном зачете XXVIII летней Всемирной Универсиады -2015 г.; победитель Всероссийских соревнований по прыжкам в воду на призы Д.Саутина-2015 г.; бронзовый призер Чемпионата России, 2016 г.

Гарифуллина Диана – мастер спорта России по прыжкам в воду, серебряный призер Первенства России-2014 г.; победительница и призер Всероссийских соревнований по прыжкам в воду на призы Д.Саутина , «Кубок Поволжья» и «Ласточки Жигулей»-2015 г.

Абдулатипова Заира – кандидат в мастера спорта России по прыжкам в воду, серебряный и бронзовый призер Первенств России-2014-2015 г.г.; победительница и призер Всероссийских соревнований по прыжкам в воду на призы Д.Саутина, «Кубок Поволжья» и «Ласточки Жигулей»-2015г.

Давыдов Алексей – мастер спорта России по прыжкам в воду, победитель и призер Всероссийских соревнований по прыжкам в воду на призы Д.Саутина , «Кубок Поволжья» и «Ласточки Жигулей»-2015г.; бронзовый призер первенства России по прыжкам в воду среди юниоров, 2016 г.

Результаты:

За период работы ее воспитанники становились неоднократными победителями и призерами Спартакиад учащихся России, Универсиад, Первенств, Чемпионатов и Кубков России, Всероссийских соревнований: МС Кандрашин Александр, МС Гарифуллина Диана, Давыдов Алексей, Абдулатипова Заира и другие.

Ирина Викторовна был поощрена благодарственными письмами управления физической культуры и спорта мэрии г.о.Тольятти, благодарственным письмом мэра г.о.Тольятти, Благодарностью Министра спорта РФ. Победитель областного конкурса по версии газеты «Спортивное обозрение Самарской губернии и ПФО» в номинации «Лучший  детский тренер » 2013 и 2015 г. г.

«У меня нет оснований отдавать Майю замуж»

Телемама не одобряет выбор дочери. Ирина Донцова заявила Dom2Life.ru, что Леша Купин — не самая прекрасная кандидатура в мужья для Майи Донцовой. Женщина обратилась к потенциальному зятю с предложением сначала завоевать ее доверие, а уже потом говорить о свадьбе с девушкой.

Майя Донцова с мамой Ириной Михайловной
​Фото: «Инстаграм»

Леша Купин и Майя Донцова уже много месяцев говорят о свадьбе, но пока дальше разговоров дело не движется. Это происходит в том числе и из-за того, что девушку постоянно накручивает ее мама. Ирина Михайловна, в свою очередь, объясняет, что совершенно не доверяет Леше Купину и считает, что он — не подходящая партия для ее прекрасной наследницы.

«Дело в том, что мне на данный момент вообще не нравится поведение Леши, потому что он больше любит себя, нежели Майю. И его отношение к ней кажется фарсом. На мой взгляд, он должен вести себя более уверенно, потому что в отношениях они, как-никак, полтора года, и если он говорит, что они идут к свадьбе, то это просто слова. Он не делает ничего», — объяснила Dom2Life.ru Донцова-старшая.

Мама Майи не видит, что Леша любит ее дочь
​Фото: «Инстаграм»

Ирина Михайловна объяснила, что постоянно плавающая дата свадьбы — лишнее тому доказательство. По мнению женщины, такое непостоянство рано или поздно приведет к краху, но никак не к торжественной церемонии. Леша Купин: «Моя свадьба состоится уже в конце года»

«Он сначала говорил, что свадьба будет в августе, потом речь шла об октябре, а теперь уже конец года, оказывается! Весело получается. Короче, его слова расходятся с действиями. Это несерьезный подход к делу. Мужчина сказал, мужчина сделал. А так вообще лучше бы ничего не говорил!» — уверена Донцова.

Также маме Майи кажется, что и в конце года ее дочь замуж не выйдет, поскольку ее избранник найдет повод уклониться от этого. Сначала был вылет из конкурса «Свадьба на миллион», потом — аппендицит Леши и другие проблемы со здоровьем, затем — нехватка документов и, как следствие, отлет на Сейшелы, где невозможно провести официальную регистрацию.

Свадьба Леши и Майи под угрозой из-за мамы
Фото: «Инстаграм»

«Свадьба — это затратное и хлопотное мероприятие. И в денежном эквиваленте они должны собирать их семимильными шагами, но я так понимаю, что денег нет. Думаю, это будет следующей причиной, чтобы отложить эту свадьбу.

Я не могу сказать, что я против этого жениха. Потому что выбор дочки — это ее выбор, и только ей с этим жить. Но мое материнское сердце неспокойно, и я очень волнуюсь: не хочу, чтобы получилась филькина грамота. Поэтому я стараюсь открывать ей глаза на некоторые моменты. Леше не нравится, что я как мама влезаю в эти отношения. Но я ему объяснила на Поляне, что если я увижу в нем ту опору и надежную стену, и если моя Майя будет за мужем, то тогда я успокоюсь и отпущу ее под венец. Но пока у меня нет основания этого делать. У меня душа не спокойна. И я это говорю честно», — подытожила Донцова в разговоре с Dom2Life.ru.

Совет депутатов 


муниципального округа Академический 
в городе Москве

(созыва 2017-2022г)

 

Васандани Татьяна Михайловна
Избирательный округ №1
Возраст:
 37
Род занятий: Юрист, специалист по имущественным спорам с городом
Кем выдвинута: «Партия Роста»

 

Гильц Елена Александровна
Избирательный округ №3
Возраст:
 29 лет
Род занятий: юрист
Кем выдвинут: КПРФ

 


Донцова Ирина Юрьевна
Избирательный округ №2
Возраст:
 46
Род занятий: ландшафтный дизайнер. В настоящий момент домохозяйка (в феврале 2017 года я снова стала мамой, поэтому решила взять рабочую паузу и побыть немного просто мамой и женой)
Кем выдвинута: самовыдвижение

 

Жуйкова Надежда Михайловна
Избирательный округ №2
Возраст:
 50 лет
Род занятий: маркетинг
Кем выдвинут: «Партия Роста»

 

 

Красильников Владимир Александрович
Избирательный округ №1
Возраст:
 48
Род занятий: Заместитель руководителя
Кем выдвинут: партия ПАРНАС

 

 

Образцова Алиса Сергеевна
Избирательный округ №2
Возраст:
 29 лет
Род занятий: Адвокат, Адвокатская палата г. Москвы
Кем выдвинута: партия Яблоко

 

Смирнов Левон Леонидович
Избирательный округ №3
Возраст: 
39 лет
Род занятий: Руководитель клуба единоборств “Геркулес”
Кем выдвинут: КПРФ

 

Стусов Антон Александрович
Избирательный округ №3
Возраст:
 33 года
Род занятий: Адвокат
Кем выдвинут: партия Яблоко

 

 

Хананашвили Михаил Нодариевич
Избирательный округ №1
Возраст:
 32
Род занятий: ООО «Панеглиф», генеральный директор
Кем выдвинут: партия Яблоко

 

Хананашвили НодариЛотариевич
Избирательный округ №2
Возраст: 
59 лет
Род занятий: социальный инженер. Координатор благотворительных программ, Благотворительный фонд «Просвещение»
Кем выдвинут: партия Яблоко

 

Хорошилов Василий Вадимович
Избирательный округ №1
Возраст:
 33
Род занятий: инженер в НИЦ “Курчатовский институт — ИТЭФ” (ранее “Институт теоретической и экспериментальной физики имени Алиханова”)
Кем выдвинут: партия Яблоко

 

Шефер Маргарита Викторовна
Избирательный округ №3
Возраст:
 53 года
Род занятий: Председатель Общественного координационного Совета по защите прав и законных интересов членов Региональной общественной организации “Московский городской Союз автомобилистов” (РОО “МГСА” в Юго-Западном отделении).

 

Дарья Донцова список книг

Дарья Донцова – уникальный российский автор иронических детективов. Ее целевая аудитория – женщины всех возрастов и совершенно разной социальной принадлежности. Ее детективы полны искрометного юмора и интриги. Сюжет захватывает и увлекает.

Все герои ее книг – это она сама в тех или иных проявлениях характера, жизненных ситуациях и увлечениях, самым главным из которых являются животные.

Можно сказать, что заняться активной писательской деятельностью Дарью Донцову вынудило тяжелое онкологическое заболевание. Именно во время болезни она создала свой первый иронический детектив. Это новое увлечение помогло ей победить страшную болезнь и перейти на новый уровень в своей жизни.

Свои романы Дарья Донцова выпускает в шести сериях. Разные персонажи, истории и преступления.

Изюминка произведений
Неизменно одно – острый захватывающий сюжет, который заставляет читать и перечитывать, вновь и вновь удивляясь способности автора так ярко и красочно создавать свои произведения.

Серии книг Дарьи Донцовой:

  • «Даша Васильева. Любительница частного сыска».
  • «Евлампия Романова. Следствие ведет дилетант».
  • «Виола Тараканова. В мире преступных страстей».
  • «Джентльмен сыска Иван Подушкин».
  • «Детектив на диете. Татьяна Сергеева».
  • «Любимица фортуны Степанида Козлова».

Даша Васильева. Кто она?

Это довольно обеспеченная женщина, которая проживает с многочисленной семьей и животными в дачном поселке Ложкино. Водит дружбу с полковником милиции Александром Дегтяревым. Очень часто пересекается с ним, когда сует свой нос в очередное расследование.

Даша Васильева много раз выходила замуж. Имеет двоих детей – сына Аркадия и дочку Манюню. В прошлом она работала преподавателем французского языка, жила в скромной маленькой квартире, затерявшейся на окраине Москвы. Все меняется, когда ее подруга Наташа оказывается богатой наследницей. И у Даши Васильевой начинается новая жизнь. Список книг серии «Любительница частного сыска Даша Васильева»:

  1. Крутые наследнички.
  2. За всеми зайцами.
  3. Дама с коготками.
  4. Дантисты тоже плачут.
  5. Эта горькая сладкая месть.
  6. Жена моего мужа.
  7. Несекретные материалы.
  8. Контрольный поцелуй.
  9. Бассейн с крокодилами.
  10. Спят усталые игрушки.
  11. Вынос дела.
  12. Хобби гадкого утенка.
  13. Домик тетушки лжи.
  14. Привидение в кроссовках.
  15. Улыбка 45-го калибра.
  16. Бенефис мартовской кошки.
  17. Полет над гнездом Индюшки.
  18. Уха из золотой рыбки.
  19. Жаба с кошельком.
  20. Гарпия с пропеллером.
  21. Доллары царя Гороха.
  22. Камин для Снегурочки.
  23. Экстрим на сером волке.
  24. Стилист для снежного человека.
  25. Компот из запретного плода.
  26. Небо в рублях.
  27. Досье на крошку Че.
  28. Ромео с большой дороги.
  29. Лягушка Баскервилей.
  30. Личное дело женщины-кошки.
  31. Метро до Африки.
  32. Фейсконтроль на главную роль.
  33. Третий глаз – алмаз.
  34. Легенда о трех мартышках.
  35. Темное прошлое Конька-Горбунка.
  36. Клетчатая зебра.
  37. Белый конь на принце.
  38. Любовница египетской мумии.
  39. Лебединое озеро Ихтиандра.
  40. Тормоза для блудного мужа.
  41. Мыльная сказка Шахерезады.
  42. Гений страшной красоты.
  43. Шесть соток для Робинзона.
  44. Пальцы китайским веером.
  45. Медовое путешествие втроем.
  46. Приват-танец мисс Марпл.

Биография Дарьи Донцовой – неординарной и позитивной писательницы-детективщицы, которая умеет любые жизненные невзгоды отодвинуть на второй план, и увидеть в жизни массу прекрасного и светлого.

В нашей новой статье вы узнаете о сериалах, которые были сняты по мотивам любимых многими читательницами детективов русской писательницы Дарьи Донцовой.

Евлампия Романова, детектив или дилетант

Евлампия Романова, в прошлом Ефросинья – изнеженная, избалованная и не знавшая настоящей жизни, поздняя дочь оперной певицы и советского ученого. Мама выдала ее замуж, обеспечив богатым наследством. Ефросинья окончила консерваторию по классу арфы, вела скучную жизнь, полную болезней и не знала ничего об окружающем мире. Пока в один прекрасный день ее жизнь не изменилась на 180 градусов. Она обрела полноценную семью, научилась вкусно готовить и открыла детективное агентство. Список книг серии «Евлампия Романова. Следствие ведет дилетант»:

  1. Маникюр для покойника.
  2. Покер с акулой.
  3. Сволочь ненаглядная.
  4. Гадюка в сиропе.
  5. Обед у людоеда.
  6. Созвездие жадных псов.
  7. Канкан на поминках.
  8. Прогноз гадостей на завтра.
  9. Хождение под мухой.
  10. Фиговый листочек от кутюр.
  11. Камасутра для Микки Мауса.
  12. Квазимодо на шпильках.
  13. Но-шпа на троих.
  14. Синий мопс счастья.
  15. Принцесса на Кириешках.
  16. Лампа разыскивает Алладина.
  17. Любовь-морковь и третий лишний.
  18. Безумная кепка Мономаха.
  19. Фигура легкого эпатажа.
  20. Бутик ежовых рукавиц.
  21. Золушка в шоколаде.
  22. Нежный супруг олигарха.
  23. Фанера Милосская.
  24. Фен-шуй без тормозов.
  25. Шопинг в воздушном замке.
  26. Брачный контракт кентавра.
  27. Император деревни Гадюкино.
  28. Бабочка в гипсе.
  29. Ночная жизнь моей свекрови.
  30. Королева без башни.
  31. В постели с Кинг-Конгом.
  32. Черный список деда Мазая.
  33. Костюм Адама для Евы.
  34. Добрый доктор Айбандит.
  35. Огнетушитель Прометея.
  36. Белочка во сне и наяву.

Виола Тараканова

Или просто Вилка. Отлично знает немецкий язык. Была замужем за майором милиции Олегом Куприным. Но потом развелись.

Теперь Вилка подалась в мир фантазий и преступных страстей. Пишет детективы под псевдонимом Арины Виоловой. Список книг из серии «Виола Тараканова. Вмире преступных страстей»:

  1. Черт из табакерки.
  2. Три мешка хитростей.
  3. Чудовище без красавицы.
  4. Урожай ядовитых ягодок.
  5. Чудеса в кастрюльке.
  6. Скелет из пробирки.
  7. Микстура от косоглазия.
  8. Филе из золотого петушка.
  9. Главбух и полцарства в придачу.
  10. Концерт для Колобка с оркестром.
  11. Фокус-покус от Василисы Ужасной.
  12. Любимые забавы папы Карло.
  13. Муха в самолете.
  14. Кекс в большом городе.
  15. Билет на ковер-вертолет.
  16. Монстры из хорошей семьи.
  17. Каникулы в Простофилино.
  18. Зимнее лето весны.
  19. Хеппи-энд для Дездемоны.
  20. Стриптиз Жар-птицы.
  21. Муму с аквалангом.
  22. Горячая любовь снеговика.
  23. Человек-невидимка в стразах.
  24. Летучий самозванец.
  25. Фея с золотыми зубами.
  26. Приданое лохматой обезьяны.
  27. Страстная ночь в зоопарке.
  28. Замок храпящей красавицы.
  29. Дьявол носит лапти.
  30. Путеводитель по Лукоморью.
  31. Фанатка голого короля.
  32. Ночной кошмар Железного Любовника.
  33. Кнопка управления мужем.
  34. Завещание рождественской утки.

Наша новая статья посвящена книге “Сбылась мечта бегемота” Дарьи Донцовой, где мы встречаем очаровательную героиню, сплошной позитив и невероятные приключения, которые радуют и поднимают настроение.

Как заинтересовать подростка чтением? Возможно вам в этом поможет наша новая статья о книгах, которые могут быть интересными подросткам https://r-book.club/best/books/interesnye-knigi-dlya-podrostkov.html.

Иван Подушкин – единственный мужчина

Работал в частном сыскном агентстве секретарем, потом отправился в свободное плавание. Список книг серии «Джентльмен сыска Иван Подушкин»:

  1. Букет прекрасных дам.
  2. Бриллиант мутной воды.
  3. Инстинкт Бабы-Яги.
  4. 13 несчастий Геракла.
  5. Али-Баба и сорок разбойниц.
  6. Надувная женщина для Казановы.
  7. Тушканчик в бигудях.
  8. Рыбка по имени Зайка.
  9. Две невесты на одно место.
  10. Сафари на черепашку.
  11. Яблоко Монте-Кристо.
  12. Пикник на острове сокровищ.
  13. Мачо чужой мечты.
  14. Верхом на «Титанике».
  15. Ангел на метле.
  16. Продюсер козьей морды.
  17. Смех и грех Ивана Царевича.

Татьяна Сергеева – полная противоположность

Полная как в прямом, так и в переносном смысле. Героиня не имеет ничего общего с Дарьей Донцовой. Татьяна Сергеева темноволосая дама в теле, начитанная и очень интеллигентная. Замужем за Аристархом Бабулькиным, сотрудником секретной группы. Список книг серии «Детектив на диете. Татьяна Сергеева»:

  1. Старуха Кристи – отдыхает.
  2. Диета для трех поросят.
  3. Инь, янь и всякая дрянь.
  4. Микроб без комплексов.
  5. Идеальное тело Пятачка.
  6. Дед Снегур и Морозочка.
  7. Золотое правило Трехпудовочки.
  8. Агент 013.
  9. Рваные валенки мадам Помпадур.
  10. Дедушка на выданье.
  11. Шекспир курит в сторонке.
  12. Версаль под хохлому.
  13. Всем сестрам по мозгам.
  14. Фуа-гра из топора.
  15. Толстушка под прикрытием.
  16. Сбылась мечта бегемота.

Сколько приятных возможностей провести вечер – другой за прочтением легкого, интересного и приятного иронического детектива прекрасного автора. Приятных вам вечеров в обществе Дарьи Донцовой!

4.2 / 5 ( 11 голосов )

Ирина Донцова из Дом 2 — Дом2

В октябре 2016 года на шоу пришла очередная мама участника, а точнее участницы. На телестройку приехала Ирина Михайловна, которая является мамой Майи Донцовой. Женщина приехала на шоу, чтобы найти для дочери жениха, и… задержалась на проекте, как это бывало со многими другими мамами на шоу.

Краткая биография

Ирина родилась 9 января 1972 года, по гороскопу она — козерог. Майю Ирина родила в 20 лет, и Майя — единственная дочь Ирины. О роде деятельности Ирины известно, что она занимается продажей ювелирных украшений. О личной жизни Ирины известно, что она замужем, однако кто муж, чем занимается — информации нет.

Отношение телезрителей и участников к маме

Телезрители обвиняют маму в излишнем участии в жизни дочери, а также в любви к «халяве», так как мама пользуется благами телепроекта и получает зарплату, как и все участники. Сами участники в основном недовольны наличием мамы на шоу, которая позволяет себе высказываться, как хочет про других героев телестройки, а также готова плести интриги.

Будущий зять

Сейчас Майя состоит в паре с Алексеем Купиным, но изначально Ирина Михайловна была против этих отношений. По словам Алексея, Ирина была против парней Майи из-за плохого отношения к дочери, а увидев отношение Леши — она изменила свое мнение и стала поддерживать нового бойфренда. Молодой человек настолько был уверен в чувствах, что очень быстро сделал предложение Майе, правда, девушка была не готова так быстро отправиться в ЗАГС, посчитав, что долго пройти, как минимум — полгода. В мае 2017 года, Майе предстояла разлука с мамой, ведь они с Алексеем улетели на Остров любви, где решили проверить свои чувства в новых обстоятельствах. Теперь Майя может быть на связи лишь по телефону или через плазму с мамой, и мама сможет влиять на дочь меньше.
Чем закончится история пары на острове? Будем ждать развития событий. А Ирина Михайловна же по-прежнему остается на поляне проекта и уходить не собирается.

Страницы в соцсетях

Ирина Михайловна в вк: Перейти
Ирина Михайловна в инста: Перейти

Дарья донцова: биография, творчество и фото

array(3) {
  [0]=>
  array(50) {
    [0]=>
    string(115) "046d732a0998ebe945d280971c6c8962.jpeg"
    [1]=>
    string(115) "ecb8f14326987c08d615ee1efdd1a4b0.jpeg"
    [2]=>
    string(115) "a1a0888f6e02fc8fb48c7fbae7266b6f.jpeg"
    [3]=>
    string(115) "1f01e28cc160abee7c842e0b4cf01ae2.jpeg"
    [4]=>
    string(115) "2ea15c56525c1136fd4e4a5f7305965d.jpeg"
    [5]=>
    string(115) "54f8eeec7bcdaaaa11421b1d7c71c269.jpeg"
    [6]=>
    string(115) "b13b24a616e55a2cf82fd1eb29b87d23.jpeg"
    [7]=>
    string(115) "66e9b483eb998c63dd722dd2b37957a3.jpeg"
    [8]=>
    string(115) "a8b3ef9b54de82dfb6ef636f85e6ad34.jpeg"
    [9]=>
    string(115) "1a19d3d8c7e407216195d4bc22616290.jpeg"
    [10]=>
    string(115) "23cc346c1d35200e420633a7757c721c.jpeg"
    [11]=>
    string(115) "ef3335064feb0abed27d4048db3cf9fc.jpeg"
    [12]=>
    string(115) "b0a152323241e7f86a29737a6815ad3c.jpeg"
    [13]=>
    string(115) "8ab65044834135bcefd21aa848550112.jpeg"
    [14]=>
    string(115) "be02457d587e122948b15609ff4463f7.jpeg"
    [15]=>
    string(115) "f8990ce6149833c838f052fc9ee4e70a.jpeg"
    [16]=>
    string(115) "966acb3f74e8aa76d2a0568d20c85bea.jpeg"
    [17]=>
    string(115) "e1994cb11f4e571d4826b4fd9236bea0.jpeg"
    [18]=>
    string(115) "9f861e85e4cd935d4dd7ff4f79de50e4.jpeg"
    [19]=>
    string(115) "3681a94ef64737607e6b6482b2e399ac.jpeg"
    [20]=>
    string(113) "17878ce72c10ba58a1721b4a72656cd2.png"
    [21]=>
    string(115) "1ddfc506a50d5d5820b0ffc58276e4b0.jpeg"
    [22]=>
    string(115) "222a480ca4bb86a6ef84cc638c89955f.jpeg"
    [23]=>
    string(115) "b76c378d45b610c2bea3c9ee33f052c2.jpeg"
    [24]=>
    string(115) "db280f4f73fecaf9774a97c6dbf90759.jpeg"
    [25]=>
    string(115) "e53f04271fe0042dbb66aae14ad002d0.jpeg"
    [26]=>
    string(115) "90c639c36787bb8c8eaf0005fef00b22.jpeg"
    [27]=>
    string(115) "02b0fd0d9af78b1c3619110a5a4f314f.jpeg"
    [28]=>
    string(115) "b6ba95e6f3e74b75afb5c3c1bc1dd4d3.jpeg"
    [29]=>
    string(115) "536cb88f7a0d0f8f383833c5ce6d746d.jpeg"
    [30]=>
    string(115) "29314ab4cfb1f42827a48437709a7b02.jpeg"
    [31]=>
    string(115) "a0f40cc8ee150341573140b27711c977.jpeg"
    [32]=>
    string(115) "c51db39fbaf974186828c1edbb598ec9.jpeg"
    [33]=>
    string(113) "14bbe1f96cbaf2ada7449c55c2234709.png"
    [34]=>
    string(113) "273d92c9d2eef4d6d3bb607ce4755373.png"
    [35]=>
    string(115) "cbd528743f22fee4d568d74994a5f3b2.jpeg"
    [36]=>
    string(115) "a81dbd143928646a709f70a84bb5a66e.jpeg"
    [37]=>
    string(115) "f8008e802bb44d8107389c62dc8f7612.jpeg"
    [38]=>
    string(115) "d7704ebafd9c6b0a89ebea1c26e62065.jpeg"
    [39]=>
    string(115) "8331f9933212c8cdb64461b918fac3a4.jpeg"
    [40]=>
    string(115) "51b40ab88e595a868b1ab255a4f99bb1.jpeg"
    [41]=>
    string(115) "96103c32c9590c29ca515065aedd2f36.jpeg"
    [42]=>
    string(115) "fe69471a4f22b6026aa0295519f8a028.jpeg"
    [43]=>
    string(115) "e16f4f080876b39e3fa089c3807de5ca.jpeg"
    [44]=>
    string(115) "47962825d39cd9d9862f708aafe513fa.jpeg"
    [45]=>
    string(115) "1d0e42f54cf00b9cea51a6f48f6ece93.jpeg"
    [46]=>
    string(115) "fd2056e3ead530d54cefd180795ea75f.jpeg"
    [47]=>
    string(115) "3a5984dfad02c289557a039e69350312.jpeg"
    [48]=>
    string(115) "4dd8d0b3a8488d53115a8247a42dbc97.jpeg"
    [49]=>
    string(115) "b9ddfbd75c7451fdbe98507c09b71390.jpeg"
  }
  [1]=>
  array(50) {
    [0]=>
    string(63) "/wp-content/uploads/0/4/6/046d732a0998ebe945d280971c6c8962.jpeg"
    [1]=>
    string(63) "/wp-content/uploads/e/c/b/ecb8f14326987c08d615ee1efdd1a4b0.jpeg"
    [2]=>
    string(63) "/wp-content/uploads/a/1/a/a1a0888f6e02fc8fb48c7fbae7266b6f.jpeg"
    [3]=>
    string(63) "/wp-content/uploads/1/f/0/1f01e28cc160abee7c842e0b4cf01ae2.jpeg"
    [4]=>
    string(63) "/wp-content/uploads/2/e/a/2ea15c56525c1136fd4e4a5f7305965d.jpeg"
    [5]=>
    string(63) "/wp-content/uploads/5/4/f/54f8eeec7bcdaaaa11421b1d7c71c269.jpeg"
    [6]=>
    string(63) "/wp-content/uploads/b/1/3/b13b24a616e55a2cf82fd1eb29b87d23.jpeg"
    [7]=>
    string(63) "/wp-content/uploads/6/6/e/66e9b483eb998c63dd722dd2b37957a3.jpeg"
    [8]=>
    string(63) "/wp-content/uploads/a/8/b/a8b3ef9b54de82dfb6ef636f85e6ad34.jpeg"
    [9]=>
    string(63) "/wp-content/uploads/1/a/1/1a19d3d8c7e407216195d4bc22616290.jpeg"
    [10]=>
    string(63) "/wp-content/uploads/2/3/c/23cc346c1d35200e420633a7757c721c.jpeg"
    [11]=>
    string(63) "/wp-content/uploads/e/f/3/ef3335064feb0abed27d4048db3cf9fc.jpeg"
    [12]=>
    string(63) "/wp-content/uploads/b/0/a/b0a152323241e7f86a29737a6815ad3c.jpeg"
    [13]=>
    string(63) "/wp-content/uploads/8/a/b/8ab65044834135bcefd21aa848550112.jpeg"
    [14]=>
    string(63) "/wp-content/uploads/b/e/0/be02457d587e122948b15609ff4463f7.jpeg"
    [15]=>
    string(63) "/wp-content/uploads/f/8/9/f8990ce6149833c838f052fc9ee4e70a.jpeg"
    [16]=>
    string(63) "/wp-content/uploads/9/6/6/966acb3f74e8aa76d2a0568d20c85bea.jpeg"
    [17]=>
    string(63) "/wp-content/uploads/e/1/9/e1994cb11f4e571d4826b4fd9236bea0.jpeg"
    [18]=>
    string(63) "/wp-content/uploads/9/f/8/9f861e85e4cd935d4dd7ff4f79de50e4.jpeg"
    [19]=>
    string(63) "/wp-content/uploads/3/6/8/3681a94ef64737607e6b6482b2e399ac.jpeg"
    [20]=>
    string(62) "/wp-content/uploads/1/7/8/17878ce72c10ba58a1721b4a72656cd2.png"
    [21]=>
    string(63) "/wp-content/uploads/1/d/d/1ddfc506a50d5d5820b0ffc58276e4b0.jpeg"
    [22]=>
    string(63) "/wp-content/uploads/2/2/2/222a480ca4bb86a6ef84cc638c89955f.jpeg"
    [23]=>
    string(63) "/wp-content/uploads/b/7/6/b76c378d45b610c2bea3c9ee33f052c2.jpeg"
    [24]=>
    string(63) "/wp-content/uploads/d/b/2/db280f4f73fecaf9774a97c6dbf90759.jpeg"
    [25]=>
    string(63) "/wp-content/uploads/e/5/3/e53f04271fe0042dbb66aae14ad002d0.jpeg"
    [26]=>
    string(63) "/wp-content/uploads/9/0/c/90c639c36787bb8c8eaf0005fef00b22.jpeg"
    [27]=>
    string(63) "/wp-content/uploads/0/2/b/02b0fd0d9af78b1c3619110a5a4f314f.jpeg"
    [28]=>
    string(63) "/wp-content/uploads/b/6/b/b6ba95e6f3e74b75afb5c3c1bc1dd4d3.jpeg"
    [29]=>
    string(63) "/wp-content/uploads/5/3/6/536cb88f7a0d0f8f383833c5ce6d746d.jpeg"
    [30]=>
    string(63) "/wp-content/uploads/2/9/3/29314ab4cfb1f42827a48437709a7b02.jpeg"
    [31]=>
    string(63) "/wp-content/uploads/a/0/f/a0f40cc8ee150341573140b27711c977.jpeg"
    [32]=>
    string(63) "/wp-content/uploads/c/5/1/c51db39fbaf974186828c1edbb598ec9.jpeg"
    [33]=>
    string(62) "/wp-content/uploads/1/4/b/14bbe1f96cbaf2ada7449c55c2234709.png"
    [34]=>
    string(62) "/wp-content/uploads/2/7/3/273d92c9d2eef4d6d3bb607ce4755373.png"
    [35]=>
    string(63) "/wp-content/uploads/c/b/d/cbd528743f22fee4d568d74994a5f3b2.jpeg"
    [36]=>
    string(63) "/wp-content/uploads/a/8/1/a81dbd143928646a709f70a84bb5a66e.jpeg"
    [37]=>
    string(63) "/wp-content/uploads/f/8/0/f8008e802bb44d8107389c62dc8f7612.jpeg"
    [38]=>
    string(63) "/wp-content/uploads/d/7/7/d7704ebafd9c6b0a89ebea1c26e62065.jpeg"
    [39]=>
    string(63) "/wp-content/uploads/8/3/3/8331f9933212c8cdb64461b918fac3a4.jpeg"
    [40]=>
    string(63) "/wp-content/uploads/5/1/b/51b40ab88e595a868b1ab255a4f99bb1.jpeg"
    [41]=>
    string(63) "/wp-content/uploads/9/6/1/96103c32c9590c29ca515065aedd2f36.jpeg"
    [42]=>
    string(63) "/wp-content/uploads/f/e/6/fe69471a4f22b6026aa0295519f8a028.jpeg"
    [43]=>
    string(63) "/wp-content/uploads/e/1/6/e16f4f080876b39e3fa089c3807de5ca.jpeg"
    [44]=>
    string(63) "/wp-content/uploads/4/7/9/47962825d39cd9d9862f708aafe513fa.jpeg"
    [45]=>
    string(63) "/wp-content/uploads/1/d/0/1d0e42f54cf00b9cea51a6f48f6ece93.jpeg"
    [46]=>
    string(63) "/wp-content/uploads/f/d/2/fd2056e3ead530d54cefd180795ea75f.jpeg"
    [47]=>
    string(63) "/wp-content/uploads/3/a/5/3a5984dfad02c289557a039e69350312.jpeg"
    [48]=>
    string(63) "/wp-content/uploads/4/d/d/4dd8d0b3a8488d53115a8247a42dbc97.jpeg"
    [49]=>
    string(63) "/wp-content/uploads/b/9/d/b9ddfbd75c7451fdbe98507c09b71390.jpeg"
  }
  [2]=>
  array(50) {
    [0]=>
    string(37) "046d732a0998ebe945d280971c6c8962.jpeg"
    [1]=>
    string(37) "ecb8f14326987c08d615ee1efdd1a4b0.jpeg"
    [2]=>
    string(37) "a1a0888f6e02fc8fb48c7fbae7266b6f.jpeg"
    [3]=>
    string(37) "1f01e28cc160abee7c842e0b4cf01ae2.jpeg"
    [4]=>
    string(37) "2ea15c56525c1136fd4e4a5f7305965d.jpeg"
    [5]=>
    string(37) "54f8eeec7bcdaaaa11421b1d7c71c269.jpeg"
    [6]=>
    string(37) "b13b24a616e55a2cf82fd1eb29b87d23.jpeg"
    [7]=>
    string(37) "66e9b483eb998c63dd722dd2b37957a3.jpeg"
    [8]=>
    string(37) "a8b3ef9b54de82dfb6ef636f85e6ad34.jpeg"
    [9]=>
    string(37) "1a19d3d8c7e407216195d4bc22616290.jpeg"
    [10]=>
    string(37) "23cc346c1d35200e420633a7757c721c.jpeg"
    [11]=>
    string(37) "ef3335064feb0abed27d4048db3cf9fc.jpeg"
    [12]=>
    string(37) "b0a152323241e7f86a29737a6815ad3c.jpeg"
    [13]=>
    string(37) "8ab65044834135bcefd21aa848550112.jpeg"
    [14]=>
    string(37) "be02457d587e122948b15609ff4463f7.jpeg"
    [15]=>
    string(37) "f8990ce6149833c838f052fc9ee4e70a.jpeg"
    [16]=>
    string(37) "966acb3f74e8aa76d2a0568d20c85bea.jpeg"
    [17]=>
    string(37) "e1994cb11f4e571d4826b4fd9236bea0.jpeg"
    [18]=>
    string(37) "9f861e85e4cd935d4dd7ff4f79de50e4.jpeg"
    [19]=>
    string(37) "3681a94ef64737607e6b6482b2e399ac.jpeg"
    [20]=>
    string(36) "17878ce72c10ba58a1721b4a72656cd2.png"
    [21]=>
    string(37) "1ddfc506a50d5d5820b0ffc58276e4b0.jpeg"
    [22]=>
    string(37) "222a480ca4bb86a6ef84cc638c89955f.jpeg"
    [23]=>
    string(37) "b76c378d45b610c2bea3c9ee33f052c2.jpeg"
    [24]=>
    string(37) "db280f4f73fecaf9774a97c6dbf90759.jpeg"
    [25]=>
    string(37) "e53f04271fe0042dbb66aae14ad002d0.jpeg"
    [26]=>
    string(37) "90c639c36787bb8c8eaf0005fef00b22.jpeg"
    [27]=>
    string(37) "02b0fd0d9af78b1c3619110a5a4f314f.jpeg"
    [28]=>
    string(37) "b6ba95e6f3e74b75afb5c3c1bc1dd4d3.jpeg"
    [29]=>
    string(37) "536cb88f7a0d0f8f383833c5ce6d746d.jpeg"
    [30]=>
    string(37) "29314ab4cfb1f42827a48437709a7b02.jpeg"
    [31]=>
    string(37) "a0f40cc8ee150341573140b27711c977.jpeg"
    [32]=>
    string(37) "c51db39fbaf974186828c1edbb598ec9.jpeg"
    [33]=>
    string(36) "14bbe1f96cbaf2ada7449c55c2234709.png"
    [34]=>
    string(36) "273d92c9d2eef4d6d3bb607ce4755373.png"
    [35]=>
    string(37) "cbd528743f22fee4d568d74994a5f3b2.jpeg"
    [36]=>
    string(37) "a81dbd143928646a709f70a84bb5a66e.jpeg"
    [37]=>
    string(37) "f8008e802bb44d8107389c62dc8f7612.jpeg"
    [38]=>
    string(37) "d7704ebafd9c6b0a89ebea1c26e62065.jpeg"
    [39]=>
    string(37) "8331f9933212c8cdb64461b918fac3a4.jpeg"
    [40]=>
    string(37) "51b40ab88e595a868b1ab255a4f99bb1.jpeg"
    [41]=>
    string(37) "96103c32c9590c29ca515065aedd2f36.jpeg"
    [42]=>
    string(37) "fe69471a4f22b6026aa0295519f8a028.jpeg"
    [43]=>
    string(37) "e16f4f080876b39e3fa089c3807de5ca.jpeg"
    [44]=>
    string(37) "47962825d39cd9d9862f708aafe513fa.jpeg"
    [45]=>
    string(37) "1d0e42f54cf00b9cea51a6f48f6ece93.jpeg"
    [46]=>
    string(37) "fd2056e3ead530d54cefd180795ea75f.jpeg"
    [47]=>
    string(37) "3a5984dfad02c289557a039e69350312.jpeg"
    [48]=>
    string(37) "4dd8d0b3a8488d53115a8247a42dbc97.jpeg"
    [49]=>
    string(37) "b9ddfbd75c7451fdbe98507c09b71390.jpeg"
  }
}

Детство и юность

Дарья Донцова (настоящее имя – Агриппина Аркадьевна Донцова) родилась в Москве в 1952 году в творческой семье. При рождении девочку назвали Агриппина в честь бабушки. На момент рождения дочки родители еще не были официально расписаны, так как отец состоял в предыдущем браке. Пара оформила отношения только в 1959 году. Отец был писателем, а мама работала в Москонцерте режиссером.


Дарья Донцова в детстве и сейчас

Первое время семья жила в бараке. Когда же его расформировали, Агриппине с бабушкой пришлось год жить без родителей, потому что комната, которую выделили семье, была слишком маленькой. Только в 1957 году они получили новую просторную квартиру в новостройке рядом со станцией «Аэропорт». В доме родителей часто собирались именитые гости, поэтому Дарья была лично знакома с писателем Валентином Катаевым и возлюбленной Владимира Маяковского Лилей Брик.

Родители заботились о развитии Агриппины, поэтому отдали ее в музыкальную школу, но обнаружилось, что девочка лишена способностей к музицированию. В школьные годы будущая писательница не отличалась успехами в познании точных наук. Но она с удовольствием изучала иностранные языки.


Дарья Донцова в молодости с отцом

Еще с дошкольного возраста у Агриппины обнаружились склонности к языкам. У нее было 2 няни – француженка и немка. По-русски они почти не говорили, что положительным образом повлияло на обучение девочки. В 1964 году, будучи школьницей, она побывала в ФРГ вместе с отцом – там местное издательство собиралось издать произведение его авторства. Из Германии девочка привезла с собой множество книг на немецком языке. В молодости она увлеклась литературными произведениями разных авторов, в том числе и зарубежных.

Книги

Обладая склонностью к гуманитарным наукам, девушка поступила в МГУ на факультет журналистики. Окончив университет, она в течение 2 лет работала в сирийском консульстве СССР переводчиком французского. Возвратившись из Сирии, Дарья 7 лет была журналистом в печатных изданиях «Отчизна» и «Вечерняя Москва».

Первая повесть была написана в 1984 году, но в журнале «Юность» литературные пробы девушки никого не заинтересовали. Впрочем, писательница не отчаивалась и попробовала себя в другом жанре.


Дарья Донцова с книгами

В 1999 году появился первый детектив «Крутые наследнички» под псевдонимом Дарья Донцова. Героиней была Даша Васильева, которая волею случая занялась частным сыском. Эту веселую, жизнерадостную книгу Донцова писала, лежа в больнице в онкологическом отделении. Когда же Дарья закончила лечение, к печати уже были готовы 5 произведений.

Первый детектив был воспринят читателями «на ура», все хотели продолжения, и оно, конечно же, последовало. Выпуском книг Донцовой занимается издательство «ЭКСМО», в общей сложности Дарья написала более 100 детективов, тираж которых составляет более 230 млн экземпляров. Каждый новый роман писательницы становится непременным бестселлером.


Дарья Донцова на презентации

В России Донцова считается одним из самых издаваемых писателей. Один роман она пишет в течение месяца. В российской Книге рекордов Гиннесса писательница записана как самый плодовитый автор. Романы Дарьи читают в России, странах бывшего СССР, а также в Китае и Западной Европе.

Книги Дарьи считаются лекарством от депрессии, в каждом произведении чувствуется неиссякаемый оптимизм писательницы. Фанаты ее творчества считают, что автограф Донцовой приносит удачу.


Автограф Дарьи Донцовой приносит удачу

Женщина работает не только в детективном жанре. В список авторских публикаций вошла книга «Кулинарная книга лентяйки», где в виде простых пособий представлены доступные рецепты для начинающих хозяек. Также Донцова написала книгу «Записки безумной оптимистки» автобиографического характера.

Однако, конечно, популярность и благосостояние Дарье принесли ее детективы. По их мотивам были отсняты сериалы, где главными героями стали Даша Васильева, Иван Подушкин, Евлампия Романова и Виола Тараканова. В съемках экранизаций участвовали популярные актеры современности – Лариса Удовиченко, Вера Сотникова, Алла Клюка, Анатолий Журавлев, Ирина Рахманова, Дмитрий Харатьян. Интересно, что в фильме серии «Любительница частного сыска Даша Васильева-4» писательница сама появилась, исполнив камео.


Дарья Донцова на фестивале «Книги России»

Дарья Донцова – троекратная обладательница премии «Писатель года», дважды получала премию «Бестселлер года» от газеты «Книжное обозрение», а также становилась лауреатом конкурса «Книга года». В 2003 году на литературной «Площади звезд» на Страстном бульваре в Москве появилась звезда Донцовой. В 2005-м писательница получила Орден Петра Великого Первой степени с лентой за заслуги в сфере литературы и личный вклад.

Постепенно знаменитая писательница поставила создание детективов на поток. Фантастическая литературная плодовитость позволила ей заполучить широкую аудиторию. В ее творческой биографии есть работы различного жанра, а новинки сразу же разбирают поклонники.


Книга Дарьи Донцовой «Штамп на сердце женщины-вамп»

Уже много лет книги Донцовой остаются в топе самых популярных среди российских читателей. Издания выходят миллионными тиражами и на полках книжных магазинов не пылятся. Ее произведения по-прежнему продолжают пользоваться популярностью в России, а в 2020 году вышла книга «Штамп на сердце женщины».

Сама писательница однажды призналась, что впадает в творческий порыв, когда начинает работу над новым произведением:


Автобиографическая книга Донцовой «Я очень хочу жить. Мой личный опыт» В 2012 году писательница выпустила автобиографическую книгу «Я очень хочу жить. Мой личный опыт». В этом произведении Донцова делится опытом победы над страшным заболеванием – раком. Дарья заболела раком груди в 1998-м.

Два неудачных брака

Любовь пришла к Дарье, когда она была студенткой первого курса МГУ. На летних каникулах она поехала отдыхать в Коктебель и повстречала там молодого человека. Звали его Дмитрий Демин. Их любовь зарождалась под крики чаек и шум прибоя. Когда влюбленные вернулись домой после отдыха, то решили пожениться.

Они не стали затягивать с этим решением. Но вскоре стало ясно, что решение о свадьбе было поспешным. Отношения между супругами стали портиться. Прошла романтика и чувство влюбленности. Оба супруга понимали, что их союз не приведет ни к чему хорошему. Не спасла положение и новость о беременности Дарьи. Супруги подали на развод, так и не дождавшись рождения сына.

Второго мужа Дарья Донцова знала с момента своей первой свадьбы. Он был на ней свидетелем. Между ней и Борисом Капустиным возникли романтические чувства и они решили не противиться судьбе и создать семью. Вместе они прожили 7 лет.

В отношениях Дарьи и Бориса все складывалось хорошо. Но в один момент они поняли, что их больше объединяет дружба нежили любовь. Расставание супругов было тихим и мирным. После развода Капустин уехал жить и работать в Америку. Там он познакомился с женщиной, которая в последствии стала его женой, а Дарья встретила своего любимого мужчину.

Личная жизнь

Личная жизнь знаменитого литератора неоднократно совершала крутые виражи. Дарья 3 раза выходила замуж, и только последний брак оказался счастливым. С первым избранником Дмитрием Деминым Донцова познакомилась в ранней молодости, будучи студенткой 1-го курса. Романтическая встреча на морском побережье Коктебеля привела молодых людей под венец. В этом союзе родился первенец писательницы – сын Аркадий. Но брак распался еще до рождения наследника.

Дарья Донцова с мужем Александром

Вторым мужем Дарьи стал Борис Капустин. Молодой человек был свидетелем на первой свадьбе писательницы. Эта встреча стала для обоих роковой. Отношения длились 7 лет, после чего супруги расстались друзьями. Борис уехал преподавать в Йельский университет.

Много лет Донцова замужем, это ее третий брак. Мужа писательницы зовут Александр, у них есть дети – общая дочь Мария и два сына – Аркадий и Дмитрий – от первого брака Донцова. Родные дети уже сделали Дарью бабушкой. В семье сына подрастает внук Никита, а у Маши в 2015 году родился мальчик Михаил.

Дарья Донцова с мужем, детьми и внуками

Семья Донцовых и сегодня остается дружной и сплоченной. Александр поддержал Дарью во время лечения онкологии. Перед ответственной операцией писательница поинтересовалась у супруга, останется ли он с ней после мастэктомии. На что Александр ответил, что даже если от жены останется только одно ухо, он будет жить с этим ухом.

Поклонникам писательницы известно ее хобби – домашние питомцы. Особенную слабость Донцова питает к мопсам, сделав этих милых собачек частью собственного имиджа. В доме Дарьи живут 4 мопса. Им составляют компанию кот британской породы и черепаха.

Дарья Донцова с собаками и котом

Помимо того, что фото мопсов регулярно украшают обложки всех книг автора, практически каждый пост в персональном «Инстаграме» она посвящает четвероногим любимцам.

Тиражи и число изданных книг

В 2012 году под именем Донцовой было издано 139 наименований книг и брошюр суммарным тиражом 3 млн. 728,6 тыс. экз., в 2013 году — 143 наименования книг и брошюр суммарным тиражом 2 млн. 631,5 тыс. экз., в 2014 году — 95 наименований книг и брошюр суммарным тиражом 1 млн. 683 тыс. экз, в 2015 году —117 наименований книг и брошюр суммарным тиражом 1 млн. 968 тыс. экз., в 2016 году — 123 наименования книг и брошюр суммарным тиражом 1 млн. 308,5 тыс. экз., в 2017 году — 98 наименования книг и брошюр суммарным тиражом 1 млн. 349 тыс. экз., в 2018 году — 82 наименования книг и брошюр суммарным тиражом 1 млн. 53 тыс. экз. Таким образом, с 2012 по 2018 год количество наименований уменьшилось в 1,7 раз, в то время как суммарный тираж в 3,5 раз. Несмотря на это, на протяжении всех этих годов Донцова занимала первое место в рейтинге наиболее издаваемых авторов взрослой художественной литературы. Однако с 2014 года разрыв между первым и вторым местом стал постепенно сокращаться (с небольшим увеличением в 2015 году) — в 1,3 раза по количеству наименований и в 1,5 раз по суммарному тиражу в 2014 году и в 0,56 раз по количеству наименований и в 1,18 раз по суммарному тиражу в 2018 году.

Творчество

Агриппина в детективах использует не только придуманные сценарии, но в них можно найти много автобиографических историй из жизни, характеров героев. Со слов писательницы, она переживает совместно со своими героями все сюжетные повороты. В детективах можно найти много юмора, интересных историй с интригующей развязкой, где добро всегда побеждает зло.

С книгами Дарьи Донцовой отдыхаешь, именно поэтому она так популярна и известна как в России, так и в Западной Европе, и Китае.

Над каждым произведением Дарья работает очень быстро. Ежедневно она пишет несколько страниц рукописного текста, отображая свои истории на бумаге с помощью ручки, а не компьютера. Набор текста в электронном виде производится непосредственно в редакции. Каждая книга, написанная Агриппиной, становится бестселлером. Согласно данных Книжной палаты, писательница возглавила список самых издаваемых авторов России.

Дарья Донцова сейчас

Писательница продолжает участвовать в мероприятиях, посвященных поддержке раковых больных. В 2020 году Дарья стала телеведущей авторской программы «Я очень хочу жить» на канале «Спас». В передаче выступают люди, которые живут с тяжелой болезнью или сумели преодолеть все трудности и вылечиться. В одном выпуске гостьей проекта стала певица Корнелия Манго, которая страдает сахарным диабетом. Заболевание не помешало артистке сделать сольную карьеру.


Ведущая авторской программы «Я очень хочу жить» Дарья Донцова

Не забывает Дарья Донцова и об увлечении кулинарией. Она стала героиней передачи «Спасите, я не умею готовить» канала ТВЦ, где учила готовить телеведущего проекта Отара Кушанашвили.

Сейчас женщина увлечена написанием детских историй, первым читателем которых становится ее младший внук Михаил. В сентябре 2018-го автор представила вниманию читателей очередной труд «Страна чудес» из серии «Сказки Прекрасной Долины».

На декабрь запланирован выпуск новой книги этой же серии – «Деревня драконов». Главные герои повествования – жители страны Мопсхаус, члены семейства мопсов. Сестры Кука и Зефирка отправляются на поиски своих родственников, которых украл дракон.

Карьера

Закончив школу, Агриппина поступила в МГУ им. М.В.Ломоносова на факультет журналистики. Получив диплом, Донцова отправилась в Алеппо, Сирия, где на протяжении двух лет занималась переводами с французского языка, работая в Советском консульстве.

После того, как вернулась домой, с 1978 года работала корреспондентом в газете «Вечерняя Москва». Спустя пять лет сменила место работы и перешла в издательство журнала «Отчизна». В этом же году вышла замуж, и сменила девичью фамилию Васильева на фамилию мужа.

В 1986 году писательница родила дочь, после чего решилась поменять род деятельности. Ее основной работой стало преподавание иностранных языков.

В 1998 году Дарье поставили страшный диагноз — рак груди 4 стадии. Будущей народной любимице сделали четыре операции, но положительного результата достигнуто не было. Именно в период острых переживаний Дарья, находясь в больнице, начала писать детективы.

Первым ее литературным детищем стала книга «Крутые наследнички», опубликованная позже в издательстве «Эксмо». Изнуренная химиотерапией, зябко кутаясь в пальто летом, она отправилась показать роман в издательстве. К ее удивлению, он был опубликован. За время борьбы с тяжелой болезнью писательница написала 5 романов, которые в дальнейшем получили широчайшую известность. Благодаря поддержки близких, оптимизму и любви к жизни, Дарья Донцова выздоровела.

В 1999 году Агриппина взяла себе литературный псевдоним. Новые истории она пишет с большой скоростью — ежемесячно по одному произведению. Ее поклонники ожидают каждую книгу с нетерпением. В настоящее время было написано более 100 произведений, несколько сценариев к телесериалам. Общий тираж всех изданий — 100 млн экземпляров.

Помимо написания книг, Дарья Донцова предпочитает общаться со своими поклонниками посредством диалога, выступая в радиоэфирах, на телевидении в различных передачах.

Иронические Детективы

  • Крутые наследнички
  • За всеми зайцами
  • Дама с коготками
  • Дантисты тоже плачут
  • Эта горькая сладкая месть
  • Жена моего мужа
  • Несекретные материалы
  • Контрольный поцелуй
  • Бассейн с крокодилами
  • Спят усталые игрушки
  • Вынос дела
  • Хобби гадкого утенка
  • Домик тетушки лжи
  • Привидение в кроссовках
  • Улыбка 45-го калибра
  • Бенефис мартовской кошки
  • Полет над гнездом Индюшки
  • Уха из золотой рыбки
  • Жаба с кошельком
  • Гарпия с пропеллером
  • Доллары царя Гороха
  • Камин для Снегурочки
  • Экстрим на сером волке
  • Стилист для снежного человека
  • Компот из запретного плода
  • Небо в рублях
  • Досье на Крошку Че
  • Ромео с большой дороги
  • Лягушка Баскервилей
  • Личное дело Женщины-кошки
  • Метро до Африки.
  • Фейсконтроль на главную роль
  • Третий глаз-алмаз
  • Легенда о трех мартышках.
  • Темное прошлое Конька— Горбунка
  • Клетчатая зебра
  • Белый конь на принце
  • Любовница египетской мумии
  • Лебединое озеро Ихтиандра
  • Тормоза для блудного мужа
  • Мыльная сказка Шахерезады
  • Гений страшной красоты
  • Шесть соток для Робинзона
  • Пальцы китайским веером
  • Медовое путешествие втроем
  • Приват-танец мисс Марпл
  • Самовар с шампанским
  • Аполлон на миллион
  • Сон дядюшки Фрейда
  • Штамп на сердце женщины-вамп
  • Свидание под мантией
  • Другая жизнь оборотня
  • Ночной клуб на Лысой горе
  • Маникюр для покойника
  • Покер с акулой
  • Сволочь ненаглядная
  • Гадюка в сиропе
  • Обед у людоеда
  • Созвездие жадных псов
  • Канкан на поминках
  • Прогноз гадостей на завтра
  • Хождение под мухой
  • Фиговый листочек от кутюр
  • Камасутра для Микки-Мауса
  • Квазимодо на шпильках
  • Но-шла на троих
  • Синий мопс счастья
  • Принцесса на Кириешках
  • Лампа разыскивает Алладина
  • Любовь-морковь и третий лишний
  • Безумная кепка Мономаха.
  • Фигура легкого эпатажа
  • Бутик ежовых рукавиц
  • Золушка в шоколаде
  • Нежный супруг олигарха
  • Фанера Милосская
  • Фэн-шуй без тормозов
  • Шопинг в воздушном замке
  • Брачный контракт кентавра
  • Император деревни Гадюкино
  • Бабочка в гипсе
  • Ночиая жизнь моей свекрови
  • Королева без башни
  • В постели с Кинг-Конгом
  • Черный список деда Мазая
  • Костюм Адама для Евы
  • Добрый доктор Айбандит
  • Огнетушитель Прометея
  • Белочка во сне и наяву
  • Матрёшка в перьях
  • Маскарад любовных утех
  • Шуры-муры с призраком
  • Корпоратив королевской династии
  • Имидж напрокат
  • Гороскоп птицы Феникс
  • Черт из табакерки
  • Три мешка хитростей
  • Чудовище без красавицы
  • Урожай ядовитых ягодок
  • Чудеса в кастрюльке
  • Скелет из пробирки
  • Микстура от косоглазия
  • Филе из Золотого Петушка
  • Главбух и полцарства в придачу
  • Концерт для Колобка с оркестром
  • Фокус-покус от Василисы Ужасной
  • Любимые забавы папы Карло
  • Муха в самолете
  • Кекс в большом городе
  • Билет на ковер-вертолет
  • Монстры из хорошей семьи
  • Каникулы в Простофилино
  • Зимнее лето весны
  • Хеппи-энд для Дездемоны
  • Стриптиз Жар-птицы
  • Муму с аквалангом
  • Горячая любовь снеговика
  • Человек-невидимка в стразах
  • Летучий самозванец
  • Фея с золотыми зубами
  • Приданое лохматой обезьяны
  • Страстная ночь в зоопарке
  • Замок храпящей красавицы
  • Дьявол носит лапти
  • Путеводитель по Лукоморью
  • Фанатка голого короля
  • Ночной кошмар Железного Любовника
  • Кнопка управления мужем
  • Завещание рождественской утки
  • Ужас на крыльях ночи
  • Магия госпожи Метелицы
  • Три желания женщины-мечты
  • Вставная челюсть Щелкунчика
  • В когтях у сказки
  • Инкогнито с Бродвея
  • Букет прекрасных дам
  • Бриллиант мутной воды
  • Инстинкт Бабы-Яги
  • 13 несчастий Геракла
  • Али-Баба и сорок разбойниц
  • Надувная женщина для Казановы
  • Тушканчик в бигудях
  • Рыбка по имени Зайка
  • Две невесты на одно место
  • Сафари на черепашку
  • Яблоко Монте-Кристо
  • Пикник на острове сокровищ
  • Мачо чужой мечты
  • Верхом на «Титанике»
  • Ангел на метле
  • Продюсер козьей морды
  • Смех и грех Ивана Царевича
  • Тайная связь его величества
  • Судьба найдет на сеновале
  • Авоська с Алмазным фондом
  • Коронный номер мистера Х.
  • Астральное тело холостяка
  • Старуха Кристи – отдыхает!
  • Диета для трех поросят
  • Инь, янь и всякая дрянь
  • Микроб без комплексов
  • Идеальное тело Пятачка
  • Дед Снегур и Морозочка
  • Золотое правило Трехпудовочки
  • Агент 013
  • Рваные валенки мадам Помпадур.
  • Дедушка на выданье
  • Шекспир курит в сторонке
  • Версаль под хохлому
  • Всем сестрам по мозгам
  • Фуа-гра из топора
  • Толстушка под прикрытием
  • Сбылась мечта бегемота
  • Бабки царя Соломона
  • Любовное зелье колдуна-болтуна
  • Бермудский треугольник чёрной вдовы
  • Вулкан страстей наивной незабудки
  • Страсти – мордасти рогоносца.
  • Львиная доля серой мышки
  • Развесистая клюква Голливуда
  • Живая вода мертвой царевны
  • Женихи воскресают по пятницам
  • Клеопатра с парашютом
  • Дворец со съехавшей крышей
  • Княжна с тараканами
  • Укротитель Медузы горгоны
  • Хищный аленький цветочек
  • Лунатик исчезает в полночь
  • Мачеха в хрустальных галошах
  • Бизнес-план трех богатырей

Книги

Обладая склонностью к гуманитарным наукам, девушка поступила в МГУ на факультет журналистики. Окончив университет, она в течение двух лет работала в сирийском консульстве СССР переводчиком французского. Возвратившись из Сирии, Дарья семь лет работала журналистом в печатных изданиях «Отчизна» и «Вечерняя Москва».

Первая повесть была написана в 1984 году, но в журнале «Юность» литературные пробы девушки никого не заинтересовали. Впрочем, писательница не отчаивалась и попробовала себя в другом жанре.

В 1999 году появился первый детектив «Крутые наследнички» под псевдонимом Дарья Донцова. Героиней была Даша Васильева, которая волею случая занялась частным сыском. Эту веселую, жизнерадостную и интересную книгу Донцова писала, лежа в больнице в онкологическом отделении. Когда же Дарья закончила лечение, к печати уже было готово пять произведений.

Первый детектив был воспринят читателями «на ура», все хотели продолжения, и оно, конечно же, последовало. Выпуском книг Донцовой занимается издательство «ЭКСМО», на сегодняшний день Дарья написала около ста детективов, общий тираж которых составляет более 230 миллионов экземпляров. Каждый новый роман писательницы становится непременным бестселлером.

В России Донцова Дарья Васильевна считается одним из самых издаваемых писателей. Один роман она пишет примерно месяц. В российской Книге рекордов Гиннеса писательница записана как самый плодовитый автор, так как она смогла написать более 100 произведений всего за 10 лет. Романы Донцовой читают не только в России или странах бывшего СССР, но и в Китае, а также в Западной Европе.

Книги Дарьи считаются лекарством от депрессии, в каждом произведении чувствуется неиссякаемый оптимизм писательницы. Многие фанаты ее творчества считают, что автограф Донцовой приносит удачу.

Нужно отметить, что писательница работает не только в детективном жанре. Она также является автором книги «Кулинарная книга лентяйки», где в виде простых пособий представлены самые доступные рецепты для начинающих хозяек. Также Донцова написала книгу «Записки безумной оптимистки» автобиографического характера. Но, конечно, известность и благосостояние Дарье принесли ее детективы. По их мотивам были отсняты сериалы, где главными героями стали Даша Васильева, Иван Подушкин, Евлампия Романова и Виола Тараканова.

Дарья Донцова на презентации одной из своих книг

Дарья Донцова — троекратная обладательница премии «Писатель года», дважды получала премию «Бестселлер года» от газеты «Книжное обозрение», а также является лауреатом конкурса «Книга года». В 2003 году на литературной площади звезд на Страстном бульваре в Москве появилась звезда Донцовой. В 2005 году писательница получила Орден Петра Великого Первой степени с лентой за заслуги в сфере литературы и большой личный вклад.

Постепенно известная писательница поставила производство детективов на поток. Фантастическая писательская плодовитость позволила ей заполучить достаточно широкую аудиторию. В ее творческой биографии есть работы различного жанра, а новинки сразу же разбирают поклонники.

Уже много лет книги Донцовой остаются в топе самых популярных среди российских читателей. Издания выходят миллионными тиражами и особо на полках книжных магазинов не пылятся. Ее книги по-прежнему продолжают пользоваться значительной популярностью в России, а в 2016 году вышла книга «Штамп на сердце женщины».

Сама писательница однажды призналась, что впадает в определенный творческий порыв, когда начинает работу над новым произведением:

В 2012 году писательница выпустила автобиографическую книгу «Я очень хочу жить. Мой личный опыт». В этом произведении Донцова делится своим опытом победы над страшным заболеванием — раком. Дарья Донцова заболела раком груди в 1998 году.

Рождение и семья

Настоящее имя писательницы Дарьи Донцовой – Агриппина Васильева. Она появилась на свет 7 июня 1952 года в Москве.

Её отец, Аркадий Николаевич Васильев, родился в 1907 году. В молодости работал в политической спецслужбе ОГПУ. Но потом занялся литературной деятельностью, трудился в редакциях издательств «Рабочий край», «Москва», «Крокодил», «Огонёк». В Московском отделении Союза писателей он работал на должности секретаря партийной организации. Его дебют в качестве писателя состоялся в 1949 году с выходом сборника фельетонов «Бархатная дорожка». В дальнейшем Васильевым было написано много рассказов, романов, сценариев и фельетонов, многие из его произведений экранизировались («Товарищ Арсений», «Понедельник – день тяжёлый»).

Вкусный рецепт! Приготовление теста для домашней лапши

Мама будущей писательницы, Тамара Степановна Новацкая, родилась в 1917 году в польско-казачьей семье. Она работала режиссёром в Москонцерте, дружила со многими известными артистами, которых постоянно сопровождала на гастролях. Мама была очень жизнерадостным, тёплым и компанейским человеком. Тамара Степановна прожила 101 год, так что по этой линии у Дарьи Донцовой замечательная генетика долгожителей.

Дедушка по отцовской линии, Николай Васильев, трудился на ткацкой фабрике. Бабушка Агриппина, в честь которой назвали внучку, была поденщицей, мыла полы. Жили они очень бедно, порой не хватало средств не то, что на одежду, даже на пропитание. Но дедушка готов был вообще голодать, лишь бы купить в лавке дорогой керосин, карандаш и тетрадку. Он вёл дневники, причём делал это по принципу: что вижу, то пишу. А когда бабушка негодовала от того, что в доме есть нечего, а супруг снова купил тетрадь и карандаш, он спокойно отвечал ей: «Успокойся ты, Груня, я ведь не на выпивку или на курево потратился. Пойми, если я не стану писать, то заболею». Дед не имел образования, но при этом испытывал непреодолимую тягу к писательству. Всё это на генетическом уровне передалось их сыну Аркадию Васильеву, а потом и внучке Дарье Донцовой.

Дедушка по материнской линии был польским коммунистом, его настоящее имя Стефан Новацкий. Но так как он женился и стал жить в России, воевал вместе с Феликсом Дзержинским, то здесь ему дали русское имя – Степан. Бабушку звали Афанасия Шабанова, родом она происходила из богатой кисловодской семьи. В 1916 году бабушка с дедушкой поженились и уехали в Москву, где через год и появилась на свет мама будущей писательницы. В 1937 году дед был арестован и умер в лагерях, посмертно его реабилитировали. Он предвидел свой арест, поэтому заранее оформил развод, и его жену с дочкой не тронули.

Секреты стройности

Донцова совершенно не стесняется своего возраста. Даша считает, что старость проявляется в ригидности. Это когда человек постоянно придерживается одной и той же жизненной схемы, не хочет узнавать что-то новое, потерял интерес к работе, путешествиям и друзьям, когда его всё вокруг раздражает. Главный принцип Донцовой – не допустить такого внутреннего старения. А внешние признаки возраста не так уж и страшны, тем более, что с ними можно побороться при помощи физических нагрузок.

Хотя до 45 лет Даша спортом не занималась вообще. Могла раз в неделю сходить в бассейн, но без особого энтузиазма. А после онкологического заболевания Дарье назначили приём гормональных препаратов, от которых она стала прибавлять в весе. И тогда в её жизни появились фитнес-клубы. И вот уже на протяжении двадцати лет Дарья обязательно три раза в неделю занимается фитнесом под руководством тренера. Её тренировка длится три часа, два из них это жёсткие упражнения с гантелями и штангой, и один час для растяжки мышц.

Донцова сидела на диете один раз в жизни, когда её вес достиг 75 кг после первых родов. С тех пор она полностью пересмотрела и поменяла свой режим питания: она просто что-то ест, а что-то нет. В её рационе нет колбас, свинины и говядины, сладостей. Зато в ежедневное меню писательницы входят курица и индюшка, сыр и творог, рыба. Хлеб ест редко и только бездрожжевой. А вообще Даша сделала для себя вывод, что толстеют люди вовсе не от еды, а от переедания. Если в течение дня у неё появляется чувство голода, то она борется с ним орешками, сухофруктами, бананом или кусочком натурального горького шоколада.

Даша открыто призывает всех: «Люди, занимайтесь спортом, каким угодно, хотя бы просто больше ходите и гуляйте!»

Болезнь

Литератор неоднократно рассказывала в интервью о том, как она победила болезнь. Медики поставили писательнице страшный диагноз – «рак». Ей пришлось пережить 18 операций, несколько сеансов облучения, а также пройти многочисленные курсы химиотерапии.

Дарья Донцова победила рак

Она попала в больницу уже на 4-й стадии болезни и в первое время перенесла 3 операции. Надежды на полное выздоровление не было, но Донцова не падала духом и поборола страшное заболевание. Она – оптимист по жизни и, находясь в больничной палате, начала писать иронические детективы, чтобы отвлечься от страшной реальности. Смелой женщине удалось избежать депрессии и излечиться. В 2008 году Дарью выбрали послом благотворительной программы «Вместе против рака груди», которую организовала компания «Avon».

Писательница вдохновляет онкологических больных на борьбу с недугом и помогает с покупкой необходимого оборудования клиникам страны. Гонорар от издания романа «Император деревни Гадюкино» Дарья перечислила на счет Российского онкологического научного центра имени Н. Н. Блохина.

Дарья Донцова на благотворительном марше «Вместе против рака груди»

Ей пришлось столкнуться с крайне тяжелым заболеванием, которое фактически является деморализующим фактором для многих людей. То, что сломило других, сделало известную писательницу сильнее. Донцова смогла побороть рак молочной железы, а онкология не стала для женщины преградой на пути к достижению цели. Ее читатели утверждают, что именно тяжелая болезнь открыла в Донцовой писательский талант. Первые романы стали бестселлерами.

Вскоре после лечения Донцова рассказала представителям СМИ, что у людей при словах «химиотерапия» и «облучение» возникают жуткие ассоциации, но это только «надуманные мифы». Писательница, которая сумела пройти такие страдания, заявила, что все это не настолько страшно, как себе представляют окружающие.

Список источников

Ген yfiC E. coli кодирует аденин-N6 метилтрансферазу, которая специфически модифицирует A37 тРНК1Val (cmo5UAC)

  1. Головина Анна Юрьевна1,2,
  2. Сергиев Петр Васильевич1,2,
  3. Головин Андрей Васильевич1,2,
  4. Серебрякова Марина Владимировна3,
  5. Ирина Демина3,
  6. Вадим М.Говорун3 и
  7. Донцова Ольга Александровна1,2
  1. 1 Химический факультет МГУ, Москва, 119992, Россия
  2. 2 А.Н. Институт физико-химической биологии им. Белозерского МГУ им. М.В. Ломоносова, Москва, 119992, Россия
  3. 3 НИИ физико-химической медицины Минздрава России, 119992 Малая Пироговская 1а, Москва, Россия

    Абстрактные

    РНК переноса сильно модифицирована.Нуклеотид 37 петли антикодона представлен различными модифицированными нуклеотидами. В Escherichia coli валин-специфическая тРНК (cmo 5 UAC) содержит уникальную модификацию, N 6 -метиладенозин, в положении 37; однако фермент, ответственный за эту модификацию, неизвестен. Здесь мы демонстрируем, что Ген yfiC из E. coli кодирует фермент, ответственный за метилирование A37 в тРНК 1 Val .Инактивация гена yfiC устраняет образование m 6 A в тРНК 1 Val , тогда как экспрессия гена yfiC из плазмиды восстанавливает модификацию. Кроме того, немодифицированная тРНК 1 Val может быть метилирована рекомбинантным белком YfiC in vitro. Хотя метилирование m 6 A в тРНК 1 Val с помощью YfiC имеет небольшое влияние на рост клеток в стандартных условиях, ген yfiC дает преимущество роста при условия осмотического и окислительного стресса.

    Сноски

    • Запросы на переиздание: Сергиев Петр Васильевич, химический факультет МГУ, Москва, 119992, Россия, и А. Белозерский институт физико-химической биологии, лабораторный корпус А, МГУ, Москва, 119992, Россия; e-mail: петя генеби.msu.su; факс: 7-495-9393181.

    • Статья опубликована в Интернете до выхода в печать. Статья и дата публикации находятся на http://www.rnajournal.org/cgi/doi/10.1261/rna.1494409.

      • Поступила 02.12.2008.
      • Принята к печати 27 февраля 2009 г.
    • Авторские права © 2009 RNA Society

    09.01-VII. — Magnanimitas



    Социальные науки


    ЛОКАЛИЗАЦИЯ ИНОСТРАННЫХ ПРЕДПРИЯТИЙ В РОССИЙСКОЙ ФЕДЕРАЦИИ В КОНТЕКСТЕ САНКЦИОННЫХ ОГРАНИЧЕНИЙ, ПОЛИТИЧЕСКИХ ОГРАНИЧЕНИЙ И ПОЛИТИЧЕСКИХ УСЛОВИЙ ТИМОФЕЙ MAZURCHUK, ANTONINA Шаркова

    ОЦЕНКА РИСКОВ ЧЕРЕЗ многофакторной регрессионная МОДЕЛЬ В УЧЕТЕ И ОТЧЕТНОСТЬ
    ЛЮДМИЛА Донцова, ИРИНА Климова, НАТАЛЬЯ БОНДАРЧУК

    РАЗВИТИЕ СОВРЕМЕННЫХ ПОЛИТЕХНИЧЕСКОЕ ОБРАЗОВАНИЯ НА ФИЗИКАХ КЛАССОВ
    GIZATULLA Имашевой BAYAN KUANBAEVA, MAIRAGUL Рахметов, Жадыр САЛЫКБАЕВА, АКТИВ ТУРКМЕНБАЕВА, ЖАНСАЯ ИСАТАЕВА, БАКИТЖАН МУРЫНОВ, АРАЙГУЛ ГАЙНЕВА

    ОСНОВЫ ЦИФРОВОЙ ЭКОНОМИКИ
    ИННА ЛИТВИНЕНКО, АНДАРЬЯ СИСТЕМЬЕВА 900, ИРИНА СМИРНОВА КОЛЛЕКЦИЯ УЧАЩИХСЯ МОТОРНАЯ МОЩНОСТЬ
    ВАЛЕРИЙ ПАНАЧЕВ, ЛЕОНИД ЗЕЛЕНИН, АНАТОЛИЙ ОПЛЕТИН, АЛЕКСАНДР ЛЕГОТКИН, ЛАРИСА ЛЕГОТКИНА, РАФИЛЯ КУСЯКОВА, ВАЛЕНТИНА ЗВЯГИНА, НИКОЛАЙ ПОНОВАЛ, 900, ВАЛЕНТИНА ЗВЯГИНА, НИКОЛАЙ ПОНОВАЛ, 900 УСТАНОВЛЕННЫЙ МЕТОД ГОСУДАРСТВЕННОГО И МУНИЦИПАЛЬНОГО УПРАВЛЕНИЯ В СОВРЕМЕННОЙ РОССИИ?
    ВАЛЕРИЙ Шлычки, ПАВЕЛ BATAYKIN, ДИАНА NESTULAEVA СЕРГЕЙ KULISH

    ОПЫТА РЕАЛИЗАЦИЯ МЕТОДИКИ СОДЕРЖАНИЯ И ЯЗЫК КОМПЛЕКСНОЕ ИЗУЧЕНИЕ В подготовке и переподготовка ЦЕНТР CLIL УЧИТЕЛЬ
    ТАНАТ AYAPOVA, зад KEMELBEKOVA, BAKHITGUL BUKABAEVA, ГУЛЬНАРА Абдрахимова, Гульжан Ержанова, Айгуль Сайфутдинова, Сажиды AITKAZY, ALIYA Касымбековой

    СТРАТЕГИЧЕСКОЕ НАПРАВЛЕНИЕ Для поддержки государственно-частного партнерства в инновационном секторе Казахстана: проблемы и перспективы
    Ержан DOMALATOV, Ardak TURGINBAYEVA

    ЛИНГВА-культурный подход к КАЗАХСКО с номерами с НАЦИОНАЛЬНЫЕ КОДЫ
    Жулдыз KURMAMBAYEVA, KALBIKE YESSENOVA, Жаналык BALTABAYEVA, САЯНСКОЙ ZHIRENOV, ABAT KDIRSHAEV, Айгуль Сембаева, KYZDARKHAN RYSBERGEN, SHAKIZAT DYUSENBBAEVA

    ПРОБЛЕМЫ национального развития в КАЗАХСТАН ПРЕСС в 1950-е и начале 1960
    SEIDUL LA Садыки, AIKERIM Алимжанов, KLARA KABYLGAZINA, коныр MYKATAYEVA, Гульнар Узбекова

    расцветки ВОПРОСОВ НАЦИОНАЛЬНОЙ ИДЕНТИФИКАЦИИ В КАЗАХСТАНЕ ПРЕССА позднесоветского ПЕРИОД
    SEIDULLA Садыков, ZHIDEGUL ABDIZHADILKIZI, KLARA KABYLGAZINA, коныр MYKATAYEVA, ALTYN AKYNBEKOVA

    ПОДГОТОВКА БУДУЩЕГО ПРЕПОДАВАТЕЛЯ ДЛЯ ОЦЕНКИ РЕЗУЛЬТАТОВ ПРЕПОДАВАНИЯ В КОНТЕКСТЕ ФОРМИРОВАНИЯ ЕГО ТЕХНОЛОГИЧЕСКОЙ КОМПЕТЕНТНОСТИ
    АКБОТА БЕКБОЛАТОВА, САЛИХ ТУНА, ЖАМИЛЯ ТОРЫБАЕВА, БАКТИЯР УШЛЛ АС, 900 83 ФОРМИРОВАНИЕ ПРОЕКТНОЙ ДЕЯТЕЛЬНОСТИ БАКАЛАВРОВ
    РИММА МАССЫРОВА, ВИКТОРИЯ САВЕЛЬЕВА

    ЯЗЫКОВАЯ ЛИЧНОСТЬ В КОНТЕКСТЕ ЖУРНАЛИСТИКИ (СМИ)
    ГАУХАР АСУЛЬТАНОВА ЛАЙКОВАЯ МАССЫЛОВА
    ГАУХАР ЕРСУЛТАНОВА ЭСУЛЕНЬОВА 900, КАЛБИКОВА 900, ГУХАР ЕРСУЛТАНОВА, КАЛБИКОВА, 900 ИСТОЧНИК ПРАВА
    АК-ADIL ALAIDAROV, TOKIJAN AGDARBEKOV, BALGABAI Накипов

    вопрос интеграции компетенции и мета-КОМПЕТЕНТНОСТИ учитель начальных классов
    Карашаш ZHANADILOVA, Нуржан KUDABAYEVA, Балжан IXATOVA, SAULE ALIASKAROVA, Зухра ZUBAIRAYEVA, Aisulu Шаяхметова

    ТЕОРИЯ И ПРАКТИКА ПРОФЕССИОНАЛЬНОЙ ПОДГОТОВКИ БУДУЩИХ УЧИТЕЛЕЙ НАЧАЛЬНОЙ ШКОЛЫ В КОНТЕКСТЕ МОДЕРНИЗАЦИИ ОБРАЗОВАНИЯ
    ГУЛЬСУМ АЯПБЕРГЕНОВА, АРНА АПЛАШОВА, БАКЖААН ДЛИМБЕТОВА, ЖУЛДЫГАТА , ЖУЛДЫГАТА ИНОЯЗЫЧНАЯ КОММУНИКАТИВНО-ОТРАСЛЕВАЯ КОМПЕТЕНТНОСТЬ СТУДЕНТОВ НЕЯЗЫКОВЫХ ВУЗОВ
    АЛИЯ ЖАМАЛИЕВА, ТУЛЕБАК КУЛГИЛДИНОВА, АРИЛИ САРСЕМБАЕВА

    ИЗМЕНИТЬ МОДЕРНИЗАЦИЮ СИСТЕМЫ ВЫБОРА КУЛГИЛДИНОВ КАНАЙСКОГО ЯЗЫКА В СИСТЕМЕ ВЫБОРА МОДЕРНИЗАЦИИ ЯЗЫКА В СИСТЕМЕ ВЫБОРА ЯЗЫКА В КАНАЙСКОЙ СИСТЕМЕ ВЫБОРА ЯЗЫКА В СИСТЕМЕ ВЫБОРА ЯЗЫКА В СИСТЕМЕ ВЫБОРА КУЛГИЛДИНОВА ИЛИ МЕЖДУНАРОДНЫЙ ОПЫТ
    ЖУМАБЕК БУСУРМАНОВ, АЙМАН КУССАИНОВА, ЛАЗЗАТ НАЗАРКУЛОВА, АЛМАС САЛПЕКОВ, ЕРКЕБУЛАН АССАНБАЕВ

    К.МУСАЕВ О ТУРЕЦКОМ АЛФАВИТЕ: ВЕЧНАЯ ТРАДИЦИЯ И ПРОБЛЕМЫ СОЮЗОВ
    САНДЫБАЙ БОРАНБАЕВ, НУРГАЛИ КАШКИНБАЕВ

    ПРОБЛЕМЫ ФОРМЫ ЗАКОНА: ТЕКУЩИЙ ГОСУДАРСТВЕННЫЙ ГОСУДАРСТВЕННЫЙ НАУК


    ДАУРЕН ТЯЖЕЛЫЙ БАКТЕРИАЛЬНЫЙ ПНЕВМОКОККАЛЬНЫЙ МЕНИНГИТ У 5 МЕСЯЦЕВ. ВЫЗВАННЫЕ ЗАМЕНЫ серотипа 24ABF

    БАЯН TURDALINA, ALIYA SEIDULLAYEVA, Гюлнар Жаксылыкова, DINAGUL BAYESHEVA, Бахыт KOSHEROVA, Ляззат YERALIYEVA, САМАТ Кожахметов, Дэвид Гринберг, АЛМАГУЛЬ KUSHUGULOVA

    сельского хозяйства


    ВОЗМОЖНОСТЬ сорго КУЛЬТУРЫ ЗОНИРОВАНИЯ В АЛМАТИНСКАЯ ОБЛАСТЬ РЕСПУБЛИКИ КАЗАХСТАН
    ДАНА МУКАШЕВА, ЕДИЛ КИРШИБАЕВ, РАУАН ЖЕКСЕМБИЕВ, ГАЛИЯ БАЙСЕИТОВА, ЗАРИНА РАХИМОВА, МИРЗАБАЙ ЖЕТИМОВ под лицензией Creative Commons


    .0 Международная лицензия.

    Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    Ассоциация инсулинорезистентности, артериальной жесткости и длины теломер у взрослых, не страдающих сердечно-сосудистыми заболеваниями

    Абстрактные

    Фон

    Хроническое воспаление и окислительный стресс можно считать ключевыми механизмами старения. Инсулинорезистентность (ИР) — это явление, связанное с воспалительным и окислительным стрессом. Мы проверили гипотезу о том, что ИР может быть связан с клеточным старением, что измеряется длиной теломер лейкоцитов (LTL) и артериальной жесткостью (основной признак старения артерий), измеренной по скорости пульсовой волны в сонно-бедренной артерии (c-f PWV).

    Методы

    В исследуемую группу вошли 303 человека, средний возраст 51,8 ± 13,3 года, без известных сердечно-сосудистых заболеваний и регулярного употребления наркотиков. Для каждого пациента измеряли кровяное давление, были доступны образцы крови для определения биохимических параметров, а LTL анализировали с помощью q ПЦР в реальном времени. C-f PWV измеряли с помощью SphygmoCor. SAS 9.1 использовался для статистического анализа.

    Результаты

    Благодаря множественному линейному регрессионному анализу c-f PWV независимо и положительно связан с возрастом (p = 0.0001) и модели гомеостаза для оценки инсулинорезистентности (HOMA-IR; p = 0,0001) и независимо отрицательно связаны с LTL (p = 0,0378). HOMA-IR, по-видимому, сильнее влияет на жесткость артерий, чем САД. У всех субъектов возраст, HOMA-IR, LTL и SBP предсказывали 32% дисперсии c-f PWV. LTL был обратно пропорционален HOMA-IR (p = 0,0001) и возрасту (p = 0,0001). У всех субъектов HOMA-IR, возраст, пол и САД предсказывали 16% дисперсии LTL.

    Выводы

    Эти данные предполагают, что ИР связан со старением клеток и старением артерий и, следовательно, может стать основной целью в предотвращении ускоренного старения артерий, помимо контроля артериального давления.Исследования в области биологии теломер могут открыть новые способы оценки сердечно-сосудистого старения и риска.

    Образец цитирования: Стражеско И., Ткачева О., Бойцов С., Акашева Д., Дудинская Е., Выгодин В. и др. (2015) Ассоциация инсулинорезистентности, артериальной жесткости и длины теломер у взрослых, не страдающих сердечно-сосудистыми заболеваниями. PLoS ONE 10 (8): e0136676. https://doi.org/10.1371/journal.pone.0136676

    Редактор: Джованни Ли Вольти, Университет Катании, ИТАЛИЯ

    Поступила: 6 марта 2015 г .; Принята к печати: 6 августа 2015 г .; Опубликован: 26 августа 2015 г.

    Авторские права: © 2015 Strazhesko et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные находятся в пределах документ и вспомогательные информационные файлы к нему.

    Финансирование: Финансирование предусмотрено Государственным заданием Минздрава России. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

    Введение

    Старение является основным маркером, влияющим на риск сердечно-сосудистых заболеваний (ССЗ), которые в значительной степени являются результатом дисфункции артерий и наложенного атеросклероза. В 2008 г. было введено понятие раннего сосудистого старения (РСВ) [1]. Основным признаком EVA является жесткость артерии, измеряемая как увеличение скорости пульсовой волны в сонно-бедренной артерии (c-f PWV) по отношению к хронологическому возрасту и полу пациента [2].Было показано, что c-f PWV является независимым маркером риска как сердечно-сосудистых событий, так и общей смертности у пациентов с артериальной гипертензией [3] и пожилых людей [4], а также в исследуемых группах, испытавших толерантность к глюкозе [5]. Ряд факторов ответственен за повышение жесткости артерий, а именно: снижение эластина и увеличение коллагена в стенке артерии, нарушение эндотелиальной регуляции тонуса гладких мышц артерий и накопление конечных продуктов гликозилирования (AGE), ведущих к перекрестному сшиванию белков [ 6].Результаты поперечных исследований связывают жесткость аорты, в частности, с ожирением, нарушением толерантности к глюкозе, сахарным диабетом 2 типа (СД2) [7], различными группами метаболического синдрома [8]. Возможно, что большая часть дополнительного риска сердечно-сосудистых заболеваний при СД2 опосредуется патофизиологическими механизмами, включающими повышенную жесткость артерий [9]. Помимо эффектов AGE, инсулино- и / или инсулинорезистентность (IR) может способствовать развитию жесткости артерий [10].ИР ассоциирован с ригидностью артерий, независимо от статуса толерантности к глюкозе [11].

    Было показано, что переменные, отличные от гормонов или метаболических показателей, например Длина теломер лейкоцитов (LTL), маркер репликативного клеточного старения, может определять или отражать биологический возраст сосудов [12]. Теломеры представляют собой тандемные повторы TTAGGG на концах хромосом, защищающие концы хромосом от эрозии во время деления клеток. Теломераза играет ключевую роль в поддержании длины теломер.У людей с короткими теломерами более вероятно ускоренное старение сосудов [13,14], атеросклероз [15], ишемическая болезнь сердца [16] и СД2 [17]. Но все еще остается неопределенность относительно роли биологии теломер в увеличении артериальной жесткости [18] и существования общих патофизиологических механизмов, включающих старение артерий и репликативное клеточное старение.

    Потеря LTL ускоряется хроническим воспалением и окислительным стрессом [19]. LTL отражает как длину теломер при рождении, так и истощение теломер в течение жизни, демонстрируя репликативный анамнез и кумулятивную окислительную нагрузку [20].Имеется мало информации о взаимосвязи скорости истощения LTL или теломер с факторами риска сердечно-сосудистых заболеваний, такими как нарушение уровня глюкозы натощак (IFG) и IR — феномен, вероятно, связанный со статусом воспалительного и окислительного стресса. Недавнее исследование молодых людей показало, что скорость истощения индивидуальных теломер сильно варьируется и сильно коррелирует с IR [21].

    Мы проверили гипотезу о том, что IR независимо связан с LTL и c-f PWV. Дополнительная цель нашего исследования состояла в том, чтобы определить, объясняет ли LTL, возможный индекс биологического старения, некоторую вариабельность жесткости аорты.

    Материалы и методы

    Дизайн исследования

    По объявлению мы набрали 450 субъектов, которые посетили Национальный исследовательский центр профилактической медицины в Москве, Россия, с мая 2012 г. по декабрь 2012 г. Для определения соответствия критериям субъекты прошли медицинский осмотр, который включал их историю болезни, физический осмотр и анализ крови. отбор проб для лабораторных анализов. Мы исключили 147 субъектов, ранее принимавших лекарства от диабета, гипертонии или гиперлипидемии; инсульт, ишемическая болезнь сердца, заболевание периферических артерий, аритмия, застойная сердечная недостаточность или порок клапанов сердца в анамнезе; печеночная или почечная недостаточность, а также рак.После этих исключений в исследование были включены 303 субъекта.

    Исследование одобрено Независимым этическим комитетом Национального исследовательского центра профилактической медицины, Москва, Россия. Информированное письменное согласие было получено от всех субъектов до включения в исследование.

    Систолическое артериальное давление (САД) и диастолическое артериальное давление (ДАД) были измерены после отдыха в течение более пяти минут в соответствии со стандартной операционной процедурой с использованием калиброванного сфигмоманометра и плечевой манжеты для накачивания (HEM-7200 M3, Omron Healthcare, Киото, Япония) .Было принято среднее значение трех последовательных чтений.

    Антропометрические измерения использовались для расчета индекса массы тела (ИМТ, ​​кг / м 2 ). После ночного голодания определяли уровень глюкозы натощак (FG) и гликозилированный гемоглобин (HbA 1c ) рутинными лабораторными методами на биохимическом анализаторе «Sapphire 400» (Niigata Mechatronics, Япония).

    Количество инсулина в сыворотке крови определяли с помощью хемилюминесцентных микрочастиц на иммуноанализаторе «Architect i 2000SR» (Abbot, Канада) [22].Оценка модели гомеостаза инсулинорезистентности (HOMA-IR) = инсулин натощак (мЕд / мл) x FG (ммоль / л) / 22,5.

    Нарушение глюкозы натощак (IFG) диагностировалось, если FG ≥ 6,1 и <7,0 ммоль / л. Во время перорального теста на толерантность к глюкозе (OGTT) уровень глюкозы натощак измеряли на исходном уровне и глюкозу после / контрольного заражения после введения 75 г глюкозы через 120 мин. Субъекты были разделены на категории с нормальной толерантностью к глюкозе (2-часовой уровень глюкозы <7,8 ммоль / л) и нарушенной толерантностью к глюкозе (IGT): 2-часовой уровень глюкозы 7.8–11,0 ммоль / л после скринингового ПГТТ.

    Жесткость артерий

    Артериальная жесткость оценивалась по значениям c-f PWV. Его измеряли с помощью оборудования SphygmoCor 8.0 (Atcor, Сидней) с помощью аппланационного тонометра и стробирования электрокардиограммы для получения пульсовых волн как от проксимальных (сонная артерия), так и от дистальных (бедренная артерия) участков. C-f PWV рассчитывалась на основе времени прохождения между двумя участками относительно зубца R в пределах комплекса электрокардиограммы с использованием «метода от ступни к ступне» и алгоритма пересекающихся касательных [23].У каждого испытуемого были выполнены две последовательности измерений, и их среднее значение было рассмотрено для анализа. Значение коэффициента повторяемости составило 0,935.

    Анализ длины теломер лейкоцитов

    LTL определяли по методу, описанному Cawthon [24]. Геномную дезоксирибонуклеиновую кислоту (ДНК) экстрагировали непосредственно из образцов крови стандартными процедурами (OD 260 нм / 280 нм 1,8–1,9). Анализ включал сравнение количества теломер ДНК с числом единственной копии геномной ДНК для каждого образца и дальнейшее сравнение нормализованного значения между ДНК из разных источников.Соотношение теломер (T) и однокопийных матриц гена 36B4 (S) отражает длину теломер (отношение T / S приблизительно равно [2 C t (теломеры) / 2 C ). t ( 36B4) ] -1 = 2 -ΔC t [T1]). Одновременно исходная смесь 1,25 x (смесь 1x: буфер для ПЦР 1x (Fermentas 10X PCR Hotstartbuf + KCl), MgCl2 2 мМ, dNTP 0,2 мМ, 0,5 мкМ каждого праймера, 0,05 единиц / мкл Taq-полимеразы Maxima (Fermentas), Sybr Зеленый I 0.2x) были подготовлены. Последовательности праймеров были: Tel1, GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT, Tel2, TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA., 36B4u, CAAGTGGGAAGGTGTAATGTAATC, 36B4d, CCCATATC. В каждую лунку с образцом добавляли шестнадцать микролитров мастер-микса и добавляли 4 мкл анализируемой геномной ДНК с концентрацией 10 нг / мкл. Образцы смешивали, центрифугировали и амплифицировали в термоциклере CFX96. Для теломерной полимеразной цепной реакции (ПЦР) мы затем нагревали при 95 ° C в течение 5 минут и проводили 35 циклов при 95 ° C в течение 20 секунд, 54 ° C в течение 2 минут с последующим плавлением.Для контрольной ПЦР нагревали при 95 ° C в течение 5 минут. Затем мы сделали 35 циклов при 95 ° C в течение 20 секунд, 58 ° C в течение 1 минуты с последующим плавлением. Амплификация соответствующих теломерных и контрольных смесей занимает одну клеточную единицу. Для каждого образца мы провели три повторяющиеся теломерные реакции и три контрольные реакции. Мы рассчитали разницу между порогами цикла амплификации теломер и одной копии гена (ΔC t ) и на основании этих результатов оценили относительную длину теломер.Геномная ДНК линии клеток НЕК и контрольный образец лейкоцитов использовали в качестве контрольной точки. Чтобы учесть различия в смесях ПЦР время от времени, мы установили референсное значение лейкоцитов ΔC t (leu) равным 8. Относительная экспоненциальная длина L была установлена ​​L = ΔC t — (ΔC t (leu) -8). Поскольку мы не получаем абсолютное значение длин теломер, поэтому в качестве меры разброса значений было решено использовать стандартное отклонение. В нашем эксперименте стандартное отклонение почти во всех случаях находилось в диапазоне 0.1–0,4, полученная из относительных длин от 8,30 до 11,39 (логарифмическая шкала).

    Анализ активности теломеразы

    Теломеразную активность (ТА) измеряли по методу, описанному Кимом [25]. Был проведен анализ клеточного экстракта из моноцитарной фракции лейкоцитов (эритроциты предотвращают анализ примесей), содержащего 2 мкг общего белка. Клетки, полученные из моноцитарного кольца в градиенте плотности фиколла и промытые PBS, повторно суспендировали в литическом буфере (10 мМ Трис-HCl и 10 мМ HEPES-KOH, pH 7.5, 1,0 мМ MgCl2, 1 мМ EGTA, 5 мМ β-меркаптоэтанол, 5% глицерин, 0,5% CHAPS, 0,1 мМ PMSF). Клетки инкубировали в течение 30 минут на льду, центрифугировали в течение 10 минут при 4 ° C в течение 15 000 g и собирали надосадочный раствор. Экстракт разделяли на аликвоты и замораживали в жидком азоте. Теломеразную полимеразную реакцию проводили с 24 мкл 1,2x мастер-микса (1x смесь содержит 1X TRAP-буфер (1x TRAP-буфер : 20 мМ HEPES-KOH pH 8 . 3 , 1) , 5 мМ MgCl2, 63 мМKCl, 1 мМ EGTA, 0,1 мг / мл БСА, 0,005% об. / Об. Твин-20), 20 пМ dNTP, 10 пмоль олигонуклеотида TS (AATCCGTCGAGCAGAGTT) и 4 мкл моноцита или контрольный экстракт.Реакционную смесь инкубировали 30 минут при 25 ° C. Продукты амплифицировали с помощью ПЦР в реальном времени. После этого 1,5 единицы Taq-ДНК-полимеразы («Helicon»), 10 пмоль олигонуклеотида ACX (CGCGGCTTACCCTTACCCTTACCCTTACC) и Sybr Green I до конечной концентрации 0,2х в смеси добавляли во льду (вместе объем 2 мкл). ПЦР в реальном времени проводили на приборе CFX-96 в течение 35 с при 94 ° C, 35 с при 50 ° C, 90 с при 72 ° C (30 циклов термоциклера Mastercycler («Bio-Rad»)). В качестве калибровочной кривой использовалась серия разведений клеточных экстрактов линии клеток HEK (активность 15 клеток была установлена ​​как 1) и TSR8 (последовательность, идентичная праймеру TS, расширенному с помощью 8 теломерных повторов AG (GGTTAG) 7 ).

    Статистический анализ

    Для статистического анализа использовали

    SAS 9.1 (Институт SAS, Кэри, Северная Каролина, США). Средние значения ± стандартное отклонение (SD) для непрерывных клинических характеристик и соответствующие пропорции / частоты для категориальных данных были вычислены и представлены в таблицах. Распределения сравнивались с использованием одностороннего дисперсионного анализа для непрерывных переменных, а также теста хи-квадрат и t-теста (с преобразованием арксинуса Фишера) для категориальных / бинарных переменных.Линейные корреляции Пирсона и коэффициенты ранговой корреляции Спирмена были рассчитаны для оценки двумерных отношений — между c-f PWV и LTL, а также клинических переменных. Был проведен множественный линейный регрессионный анализ для выявления любых независимых ассоциаций между c-f PWV и параметрами метаболизма глюкозы плюс LTL, а также между LTL и параметрами метаболизма глюкозы. Значения P менее 0,05 считались статистически значимыми.

    Результаты

    Характеристики субъектов исследования

    Всего было набрано 303 амбулаторных участника (104 мужчины и 199 женщин).Субъекты не различались по общему этническому составу, идентифицируя себя как кавказцы. Данные TA были доступны для 163 субъектов, OGTT был проведен для 231 субъекта, а данные HOMA-IR были рассчитаны для 274 субъектов. Остальные данные были доступны для всех участников. Возраст субъектов варьировался от 23 до 91 года, средний возраст — 51,8 ± 13,3 года. Из исследуемой группы у 76 субъектов была легкая или умеренная артериальная гипертензия, у 50 субъектов был СД2, а у 33 субъектов была диагностирована НТГ. Ни один из пациентов с T2DM регулярно не получал лекарства от диабета, и ни у кого не было известных микрососудистых или макрососудистых осложнений.Никто из пациентов регулярно не получал никаких других лекарств, в том числе гипотензивных.

    Исследуемая выборка была разделена на две группы по уровню HOMA-IR. ИР диагностировали при повышении HOMA-IR> 2,5 [26]. По этим критериям ИР был диагностирован у 89 человек. В таблице 1 представлены интересующие параметры в общей группе и в подгруппах, классифицированных по статусу IR. Данные представлены в виде средних значений ± стандартное отклонение (SD).

    По сравнению с субъектами с нормальным HOMA-IR, пациенты с повышенным HOMA-IR имели более высокий ИМТ (p <0.0001), FG (p <0,0001), 2h-OGTT глюкоза (p = 0,0004), HbA 1c (p <0,0001), SBP (p <0,0001), DBP (p <0,0001), cf PWV (p <0,0001 ) и более короткие LTL (p <0,0001). В «высокой» группе HOMA-IR была более высокая доля мужчин.

    Субъекты с IR (повышенный HOMA-IR) существенно не отличались от людей с нормальным HOMA-IR по возрасту и TA.

    Двумерные корреляции

    Таблица 2 представляет собой сводку двумерных ассоциаций c-f PWV и LTL.Были использованы коэффициенты корреляции Пирсона, и результаты были проверены с использованием более надежных коэффициентов ранговой корреляции Спирмена.

    Согласно результатам теста линейной корреляции Пирсона, жесткость артерий (cf PWV) достоверно и положительно коррелировала с возрастом (p = 0,0001), САД (p = 0,0001), ДАД (p = 0,0013), ФГ (p = 0,0001), HOMA-IR (p = 0,0001), 2h-OGTT глюкоза (p = 0,0001) и HbA 1c (p = 0,0001). Была выявлена ​​значимая обратная корреляция между c-f PWV и LTL (p = 0.0001), между c-f PWV и TA (p = 0,0354). Не было обнаружено корреляции между c-f PWV и полом.

    LTL значимо отрицательно коррелировал с возрастом (p = 0,0001), САД (p = 0,0394), FG (p = 0,0001), HOMA-IR (p = 0,0001), HbA 1c (p = 0,0064), незначительно отрицательно коррелировал с мужским полом (p = 0,0542). Как правило, это отрицательно коррелировало с глюкозой через 2-часовой ПГТТ (p = 0,0709), но не коррелировало с ДАД (p> 0,1). LTL имел значительную положительную корреляцию с TA (p = 0,0246), когда использовались коэффициенты ранговой корреляции Спирмена.

    Множественный регрессионный анализ

    Первым шагом в построении множественной регрессии было определение независимых переменных (которые были существенно связаны с зависимой переменной) независимо от возраста и пола для LTL, а также возраста и САД для c-f PWV. Для этой цели мы использовали объясняющие переменные, которые продемонстрировали высокую двумерную корреляцию с зависимой переменной, соответственно. Мы включили по одной объясняющей переменной в каждую модель — при обязательном включении пола и возраста с их взаимодействием для переменной LTL, а также возраста и САД с их взаимодействием для переменной c-f PWV (см. Таблицу S1 и таблицу S2).Все изученные параметры метаболизма глюкозы (FG, HOMA-IR, HbA 1c , 2-h OGTT глюкоза) и LTL могут рассматриваться как независимые переменные, связанные с c-f PWV, с поправкой на возраст и САД. Только HOMA-IR и FG могут рассматриваться как независимые переменные, связанные с LTL, с поправкой на возраст и пол.

    На втором этапе мы использовали модель множественной регрессии для определения независимого влияния HOMA-IR на жесткость сосудов (cf PWV) с поправкой на возраст, LTL, САД и независимое влияние HOMA-IR на LTL с поправкой на возраст, пол, САД.Для оценки нормальности исходных переменных были построены гистограммы c-f PWV и LTL (S1 фиг. И S2 фиг.).

    Первая модель множественного линейного регрессионного анализа использовала c-f PWV в качестве зависимой переменной и возраст, SBP, LTL, HOMA-IR в качестве независимых переменных (Таблица 3).

    Возраст составляет 20,3% вариабельности c-f PWV. На регрессионную модель с возрастом и LTL приходилось 24,1% вариабельности c-f PWV, с дополнительным изменением 3,8%, приходящимся на LTL.Модель, которая оценивала возраст, LTL и SBP, объяснила 26,5% вариабельности c-f PWV с дополнительными 2,4% вариациями, объясняемыми SBP. Когда в модель были введены возраст, LTL, SBP, HOMA-IR, HOMA-IR учитывала дополнительную 5,5% вариабельность c-f PWV. Этот анализ показал заметное влияние HOMA-IR на c-f PWV сверх эффекта SBP.

    Вторая модель множественного линейного регрессионного анализа использовала LTL в качестве зависимой переменной и возраст, пол, САД, HOMA-IR в качестве независимых переменных (см. Таблицу 4).

    Модель, которая оценивала возраст, пол, САД и HOMA-IR, объяснила 16,2% вариабельности LTL. На HOMA-IR в значительной степени приходилось 7,0% изменчивости LTL. Когда в модель были введены возраст, пол, HOMA-IR и САД, САД не было достоверно связано с вариабельностью LTL (p > 0,3).

    На рис.

    S3 и S4 показаны диаграммы разброса c-f PWV и LTL как функции HOMA-IR.

    Обсуждение

    Важным открытием нашего наблюдательного исследования является то, что все маркеры метаболизма глюкозы (FG, HbA 1c , 2-часовой уровень глюкозы OGTT, HOMA-IR) связаны с ригидностью артерий.Большинство наших пациентов не страдают СД2 (и не получают лекарственного лечения), а значения параметров метаболизма глюкозы находятся в пределах нормы. Наши результаты согласуются с выводами о том, что уровень ФГ, даже в пределах нормы, связан с ухудшением артериальной жесткости у здоровых людей, не страдающих диабетом [27]. Лукич и др. . сообщили, что 284 субъекта европеоидной расы показали положительную корреляцию между FG, HbA 1c и PWV, и что повышение артериальной жесткости началось на уровне IFG согласно сравнениям нормального уровня глюкозы, IFG и диабета [28].Эти результаты подтверждают гипотезу о том, что высокий нормальный уровень ФГ связан с повреждением органов-мишеней и сосудистой дисфункцией, независимо от других факторов, включая артериальное давление, и объясняют, почему высокий нормогликемический статус является фактором риска сердечно-сосудистых заболеваний. Кроме того, Bjornholt JV et al. после двадцати двух лет наблюдения показали, что у мужчин, не страдающих диабетом, с уровнем ФГ> 85 мг / дл риск сердечно-сосудистой смерти в 1,4 раза выше, чем у мужчин с более низким уровнем ФГ [29].

    Наши результаты подтверждают гипотезу о том, что важный глюкометаболический компонент повышенной жесткости артерий возникает до начала СД2.Такие изменения могут быть вызваны такими факторами, как карбонильный и окислительный стресс, хроническое воспаление слабой степени и дисфункция эндотелия, в том числе вызванная длительной гипергликемией и образованием AGE [30].

    IR является одним из наиболее важных факторов, влияющих на жесткость артерий. Механизм, лежащий в основе взаимосвязи между ИР и артериальной жесткостью, неизвестен. Некоторые другие исследования также обнаружили взаимосвязь между ИР и ригидностью артерий как у пациентов с диабетом, так и у здоровых молодых людей [31].Как фактор, влияющий на жесткость артерий, эффект инсулина per se имеет потенциальное значение и окончательно не установлен. Инсулин индуцировал пролиферацию и миграцию гладких мышц сосудов в культуре клеток [32]. Невосприимчивость к опосредованной эндотелием вазодилатации, связанной с ИР, может объяснить связь с ригидностью артерий [33]. Эти факторы могут способствовать артериальной жесткости до того, как разовьется нарушение толерантности к глюкозе или диабет [10]. Необходимы дальнейшие исследования для выяснения роли, которую играет гиперинсулинемия и / или ИР в прогрессировании жесткости артерий, и для определения того, опосредуют ли эндотелиальная дисфункция или пролиферация гладких мышц сосудов наблюдаемую связь.Также необходимы дополнительные исследования для оценки эффекта обратимости, то есть повышения чувствительности к инсулину как способа снижения жесткости артерий. Очень важно подчеркнуть, что HOMA-IR, по-видимому, сильнее влияет на жесткость артерий, чем САД (Таблица 3). Наши результаты подтверждают мнение Bernhard M. et al. [34], что жесткость сосудов является скорее предвестником, чем результатом гипертонии.

    Второй главный вывод показал, что c-f PWV обратно коррелировал с LTL, как предполагаемый маркер биологического старения.Это подтверждает, что люди, для которых характерны относительно короткие теломеры, демонстрируют относительно более высокий c-f PWV. Связь между LTL и c-f PWV может сохраняться не только для теломер в лейкоцитах, но также и для теломер в других реплицирующихся клетках, включая эндотелиальные клетки сосудов и клетки гладких мышц сосудов. Такие данные связывают биологическое старение крупных кровеносных сосудов со старением клеточных элементов сосудистой стенки.

    Третьим основным открытием было то, что LTL был обратно пропорционален возрасту, HOMA-IR и был короче у мужчин по сравнению с женщинами.Эти результаты согласуются с другими [21]. Поперечный анализ показал, что уровень LTL в лейкоцитах обратно пропорционален возрасту. Известно, что при рождении теломеры у мальчиков и девочек имеют одинаковую длину; однако в более позднем возрасте они относительно продолжительнее у женщин, особенно в предменопаузе, по сравнению с соответствующими мужчинами, — эффект, приписываемый эстрогену [12]. Однако некоторые из наших результатов были неожиданными. Влияние HOMA-IR было сопоставимо по величине с влиянием возраста на LTL (таблица 4).Объяснение может быть следующее. Предполагается, что ИР увеличивает окислительный стресс [35]. Окислительный стресс и воспаление считаются важными факторами, влияющими на биологию старения. Окислительный стресс вызывает однонитевые разрывы, характерные для теломер, и увеличивает ядерное удаление обратной транскриптазы теломеразы. Оба процесса ускоряют эрозию теломер. Хроническое воспаление, которое связано с повышенным обменом лейкоцитов, также связано с ускоренным истощением теломер.И LTL, и TA отражают функциональное состояние стволовых клеток-предшественников [36]. ИР, связанный с хроническим воспалением, может усиливать укорочение теломер в стволовых клетках и последующее снижение их функциональной способности. Стволовые клетки и клетки-предшественники участвуют в восстановлении поврежденной ткани и процессах дифференцировки. Таким образом, они важны для поддержания гомеостаза тканей, в том числе стенки сосуда. Мы предполагаем, что LTL отражает связь между IR и жесткостью артерий и может рассматриваться как компонент, связанный с ускоренным старением.

    Наконец, мы признаем потенциальные ограничения нашего исследования. Поскольку это исследование было поперечным, мы одновременно собирали данные о c-f PWV, теломерах, регуляции глюкозы и артериальном давлении. Такой перекрестный подход не выявляет причинно-следственных связей. Необходимы дальнейшие исследования, чтобы понять механизмы, лежащие в основе этих ассоциаций, например, с помощью вмешательств, и определить оптимальное целевое значение гликемии для предотвращения жесткости артерий в клинических условиях и в условиях общественного здравоохранения.

    В заключение, повышенная артериальная жесткость связана с более короткой длиной теломер и нарушением метаболизма глюкозы. Короткий LTL и нарушение метаболизма глюкозы можно рассматривать как негемодинамические компоненты EVA. IR связан с жесткостью артерий и LTL и, следовательно, может стать основной целью в предотвращении ускорения старения артерий, помимо контроля артериального давления. Исследования в области биологии теломер могут открыть новые способы оценки сердечно-сосудистого старения и риска.

    Благодарности

    Мы благодарны А.Кругликова, Е. Плохова, В. Пихтина, Н. Гомыранова, И. Озерова, М. Покровская, О. Исайкина, Национальный исследовательский центр профилактической медицины, Москва, Российская Федерация; а также Д. Васильковой и профессора О. Донцовой, химический факультет, Московский государственный университет им. М. В. Ломоносова, Москва, Россия, за помощь в проведении исследований.

    Вклад авторов

    Задумал и спроектировал эксперименты: IS OT SB VV PN. Проведены эксперименты: IS ED DS DA. Проанализированы данные: ИС ЭД ВВ. Предоставленные реагенты / материалы / инструменты анализа: DA ED DS.Написал бумагу: ЕСТЬ ОТ СО ПН.

    Список литературы

    1. 1. Nilsson PM, Boutouyrie P, Cunha P, Kotsis V, Narkiewicz K, Parati G, et al. Раннее сосудистое старение в переводе: от лабораторных исследований к клиническому применению в профилактике сердечно-сосудистых заболеваний. J Hypertens. 2013; 8: 1517–26.
    2. 2. Наджар С.С., Скутери А., Лакатта Е.А. Артериальное старение: является ли это неизменным фактором риска сердечно-сосудистых заболеваний? Гипертония. 2005; 46: 454–462
    3. 3. Лоран С., Бутуири П., Асмар Р., Готье И., Лалу Б., Гиз Л. и др.Жесткость аорты является независимым предиктором общей смертности и смертности от сердечно-сосудистых заболеваний у пациентов с артериальной гипертензией. Гипертония. 2001; 37: 1236–41. pmid: 11358934
    4. 4. Meaume S, Rudnichi A, Lynch A, Bussy C, Sebban C, Benetos et al. Скорость пульсовой волны в аорте как маркер сердечно-сосудистых заболеваний у лиц старше 70 лет. J Hypertens. 2001; 19: 871–7. pmid: 11393669
    5. 5. Cruickshank K, Riste L, Anderson SG, Wright JS, Dunn G, Gosling RG. Скорость распространения пульсовой волны в аорте и ее связь со смертностью при диабете и непереносимости глюкозы: интегрированный индекс сосудистой функции? Тираж.2002; 106: 2085–90. pmid: 12379578
    6. 6. Diez J. Артериальная жесткость и внеклеточный матрикс. Adv Cardiol. 2007; 44: 76–95. pmid: 17075200
    7. 7. Mitchell GF, Guo CY, Benjamin EJ, Larson MG, Keyes MJ, Vita JA и др. Поперечные корреляты повышенной жесткости аорты в сообществе: Framingham Heart Study. Тираж. 2007. 115: 2628–36. pmid: 17485578
    8. 8. Scuteri A, Cunha PG, Rosei EA, Badariere J, Bekaert S, Cockroft JR et al.Артериальная жесткость и влияние метаболического синдрома: межстрановое исследование. Атеросклероз. 2014; 233: 654–660. pmid: 24561493
    9. 9. Strain WD, Chaturvedi N, Dockery F, Shiff R, Shore AC, Christopher J. et al. Повышенная жесткость артерий у европейцев и африканцев Карибского бассейна с диабетом 2 типа не может быть объяснена обычными сердечно-сосудистыми факторами риска. Am J Hypertens. 2006; 19: 889–96. pmid: 16942929
    10. 10. Скутери А., Наджар С.С., Мюллер Д.К., Андрес Р., Хугаку Х., Меттер Э.Дж. и др.Метаболический синдром усиливает возрастное увеличение толщины и жесткости сосудов. J Am Coll Cardiol. 2004; 43: 1388–95. pmid: 15093872
    11. 11. Сенгшток Д.М., Вайткявичюс П.В., Супиано М.А. Артериальная жесткость связана с инсулинорезистентностью у пожилых людей с гипертонической болезнью, не страдающих диабетом. J Clin Endocrinol Metab. 2005; 90: 2823–2827. pmid: 15728211
    12. 12. Nilsson PM, Tufvesson H, Leosdottir M, Melander O. Теломеры и риск сердечно-сосудистых заболеваний: обновление 2013.Перевод Рез. 2013; 162 (6): 371–80. pmid: 23748031
    13. 13. Бенетос А., Окуда К., Ладжеми М., Кимура М., Томас Ф., Скурник Дж. И др. Длина теломер как индикатор биологического старения: гендерный эффект и связь с пульсовым давлением и скоростью пульсовой волны. Гипертония. 2003; 37: 381–5.
    14. 14. Ван Ю, Чен А.Ф., Ван Х.З., Се LY, Суй К.Х., Чжан Цюй. Связь более короткой средней длины теломер с жесткостью большой артерии у пациентов с ишемической болезнью сердца.Стареющий мужчина. 2011; 14: 27–32. pmid: 21067315
    15. 15. Самани Нью-Джерси, Боултби Р., Батлер Р., Томпсон Дж. Р., Гудолл А. Х. Укорочение теломер при атеросклерозе. Ланцет. 2002; 358: 472–3.
    16. 16. Fyhrquist F, Saijonmaa O, Strandberg T. Роль старения и укорочения теломер при сердечно-сосудистых заболеваниях. Nat Rev Cardiol. 2013; 10: 274–83. pmid: 23478256
    17. 17. Мурильо-Ортис Б., Альбарран-Тамайо Ф., Аренас-Аранда Д., Бенитес-Брибеска Л., Малакара-Эрнандес Дж. М., Мартинес-Гарса С. и др.Длина теломер и диабет 2 типа у мужчин: синдром преждевременного старения. Стареющий мужчина. 2012; 15: 54–8. pmid: 21824049
    18. 18. Denil SLIJ, Rietzschel ER, De Buyzere ML, Van daele CM, Segers P, De Bacquer D. et al. О поперечных ассоциациях длины теломер лейкоцитов с сердечной систолической, диастолической и сосудистой функцией: исследование Asklepios. PLoS ONE. 2014; 9 (12): e115071. pmid: 25506937
    19. 19. Серра В., фон Зглиницки Т., Лоренц М., Сарецки Г. Внеклеточная супероксиддисмутаза является основным антиоксидантом в фибробластах человека и замедляет укорочение теломер.J Biol Chem. 2003; 278: 6824–6830. pmid: 12475988
    20. 20. Авив А. Теломеры и старение человека: факты и выдумки. Sci Aging Knowledge Environ. 2004; 22: с. 43.
    21. 21. Demissie S, Levy D, Benjamin EJ, Cupples LA, Gardner JP, Herbert A и др. Инсулинорезистентность, окислительный стресс, гипертония и длина теломер лейкоцитов у мужчин из исследования сердца Фрамингема. Ячейка старения. 2006; 5: 325–30. pmid: 16913878
    22. 22. Морияма М., Хаяси Н., Охьябу К., Мукаи1 М., Кавано С., Кумагаи1 С.Оценка эффективности и перекрестной реактивности аналогов инсулина с помощью ARCHITECT Insulin Assay. Клиническая химия. 2006; 52: 1423–6. pmid: 166

    23. 23. Rajzer MW, Wojciechowska W, Klocek M, Palka I., Brzozowska-Kiszka M, Kawecka-Jaszcz K. Сравнение скорости пульсовой волны в аорте, измеренной тремя методами: Complior, SphygmoCor и Arteriograph. J Hypertens. 2008; 26: 2001–7. pmid: 18806624
    24. 24. Cawthon RM. Измерение теломер с помощью количественной ПЦР.Nucleic Acids Res. 2002; 30: e47. pmid: 12000852
    25. 25. Ким Н.В., Пятышек М.А., Проуз К.Р., Харли С.Б., Западный доктор медицины, Хо П.Л. и др. Специфическая связь активности теломеразы человека с бессмертными клетками и раком. Science.1994; 266: 2011–5. pmid: 7605428
    26. 26. Негами М., Такахаши Э., Оцука Х., Морияма К. Прогнозирование оценки резистентности к инсулину на основе модели гомеостаза у японских субъектов. Tokai J Exp Clin Med. 2012; 37: 102–6. pmid: 23238901
    27. 27. Шин JY, Ли HR Ли DC.Повышенная артериальная жесткость у здоровых субъектов с высоким нормальным уровнем глюкозы и у субъектов с предиабетом. Кардиоваск Диабетол. 2011; 10:30 pmid: 21492487
    28. 28. Лукич Э., Матас З., Боаз М., Шаргородский М. Увеличивающееся нарушение гомеостаза глюкозы связано с увеличением артериальной жесткости у пациентов с диабетом, нарушением уровня глюкозы натощак и нормальным контролем. Diabetes Metab Res Rev. 2010 26: 365–70. pmid: 20568265
    29. 29. Bjornholt JV, Erikssen G, Aaser E, Sandvik L, Nitter-Hauge S, Jervell J, et al.Уровень глюкозы в крови натощак: недооцененный фактор риска смерти от сердечно-сосудистых заболеваний. Результаты 22-летнего наблюдения за здоровыми мужчинами без диабета. Уход за диабетом. 1999; 22: 45–49. pmid: 10333902
    30. 30. Генри М.А., Костенсе П.Дж., Спийкерман AMW, Деккер Дж.М., Нейпельс Дж., Роберт Дж. И др. Жесткость артерий увеличивается с ухудшением статуса толерантности к глюкозе. Этюд Хорна. Тираж. 2003; 107: 2089–95. pmid: 12695300
    31. 31. Гилтай EJ, Lambert J, Elbers JM, Gooren LJ, Asscheman H, Stehouwer CD.Податливость и растяжимость артерий зависят от состава тела как у мужчин, так и у женщин, но чувствительность к инсулину только у женщин. Диабетология. 1999; 42: 214–21. pmid: 10064102
    32. 32. Индольфи С., Торелла Д., Кавуто Л., Давалли А.М., Коппола С., Эспозито Г. и др. Влияние баллонного повреждения на неоинтимальную гиперплазию при стрептозотоцин-индуцированном диабете и у крыс с трансплантированными островками поджелудочной железы без гиперинсулинемии. Тираж. 2001; 103: 2980–6. pmid: 11413090
    33. 33.Cersosimo E, DeFronzo RA. Инсулинорезистентность и эндотелиальная дисфункция: дорожная карта сердечно-сосудистых заболеваний. Diabetes Metab Res Rev.2006; 22 (6): 423–36. pmid: 16506274
    34. 34. Каесс Б.М., Ронг Дж., Ларсон М.Г., Вита Дж. А., Леви Д., Бенджамин Э. Дж. И др. Жесткость аорты, прогрессирование артериального давления и эпизодическая гипертензия. ДЖАМА. 2012; 308: 875–81. pmid: 22948697
    35. 35. Кини Дж. Ф. младший, Ларсон М. Г., Васан Р. С., Уилсон П. У., Липинска И., Кори Д. и др. Ожирение и системный окислительный стресс: клинические корреляты окислительного стресса в исследовании сердца Фрамингема.Артериосклер Thromb Vasc Biol.2003; 23: 434–39. pmid: 12615693
    36. 36. Oeseburg H, Westenbrink BD, de Boer RA, van Gilst WH, van Veldhuisen DJ, van der Harst P. Могут ли критически короткие теломеры вызывать функциональное истощение клеток-предшественников при постинфарктной сердечной недостаточности. J Am Coll Cardiol. 2007; 50: 1911–2.

    Формирование концепции умного устойчивого города с целью защиты окружающей среды

    использованная литература

    [1] Ангелиду М.2017. Роль характеристик умного города в планах пятнадцати городов. Журнал городских технологий, 24: 3-28.
    [2] Битли Т. и Коллинз Р. 2000. Разумный рост и не только: переход к устойчивому обществу. Журнал экологического права Вирджинии, 19 (3): 287-322.
    [3] Бенуаре, К., Валлиюр-Рамалингам, Р. и Чарой, Ф. 2013. CrowdSC: создание умных городов с широкомасштабным гражданским участием. IEEE Internet Computing, 17 (6): 57–63.
    [4] Богомолова, Л., Устюжанцева А. 2020. Проблемы обеспечения экономической безопасности северных регионов России. Utopía y Praxis Latinoamericana, 5 (Extra 5): 51-62.
    [5] Бондалетова Н.Ф., Евстратова Т.А., Демченко Т.С. Медведева, Н.В. 2020. Оценка работы органов власти в сфере социальной защиты граждан, уволенных с военной службы, и членов их семей. Utopía y Praxis Latinoamericana, 5 (Extra 5): 356-369.
    [6] Караглиу А., Дель Бо К. и Нейкамп П.2011. Умные города в Европе. Журнал городских технологий. 18 (2): 65–82.
    [7] Дамери, Р. П., Беневоло, К. 2016. Управление умными городами: эмпирический анализ. Компьютерное обозрение социальных наук, 34: 693-707.
    [8] Де Йонг, М. и др. 2015. Устойчивые, умные, устойчивые к бедствиям города с низким уровнем выбросов углерода и экологических знаний; понимание множества концепций, способствующих устойчивой урбанизации. Журнал чистого производства, 109: 25–38.
    [9] Дудин М.Н., Заско В.Н. Донцова, О. и Осокина И.V. 2020. Энергетическая политика Европейского Союза и возможности ее реализации в постсоветских странах. Международный журнал экономики и политики энергетики, 10 (2): 409-416.
    [10] Горохова А.Е. и др. 2020. Развитие технологий цифровой экономики и внедрение систем управления производством. Revista Inclusiones, 7 (Особый): 422-434.
    [11] Холландс, Р. 2008. Поднимитесь, пожалуйста, настоящий умный город? Умный, прогрессивный или предприимчивый? Городская, 12 (3): 303–320.
    [12] Иванцова, Е.А. 2016. Проблемы и перспективы обращения с твердыми отходами. Вестник Волгоградского государственного университета. Выпуск 3. Экономика, экология, 2 (35): 148-159.
    [13] Крамерс А., М. Хёйер, Н. Левехаген и Дж. Вангель. 2014. Умные устойчивые города: изучение решений ИКТ для снижения энергопотребления в городах. Экологическое моделирование и программное обеспечение, 56: 52-62.
    [14] Кремчеев Е.А., Данилов А.С. , Смирнов Ю.Д. 2019. Состояние метрологического обеспечения систем контроля на базе беспилотной авиации.Записки Горного института, 235: 96-105.
    [15] Летайфа, С. 2015. Как разработать стратегию умных городов: выявление умной модели. Журнал бизнес-исследований, 68 (7): 1414-1419.
    [16] Ломбарди, П., Джордано, С. Фару, Х. и Юсеф, В. 2012. Моделирование эффективности умного города. Инновации: Европейский журнал исследований в области социальных наук, 25 (2): 137–149.
    [17] Морозова В.В. 2019. Процессы расселения населения России. В Инновационный путь развития современной науки: теория, методология и практика: сборник материалов конференции, 29 октября 2019 г., Петрозаводск, Россия, И.Ивановская (ред.), 60-63. Петрозаводск: Международный центр научного партнерства «Новая наука».
    [18] Neirotti, P., et al. 2014. Современные тенденции в инициативах умного города — стилизованные факты. Города, 38: 25–36.
    [19] Савина, С.В. 2020. Искусственный интеллект в анализе влияния структуры капитала на финансовую устойчивость. Вестник Национальной академии наук Республики Казахстан, 1 (383): 277-287. DOI: https://doi.org/10.32014/2020.2518-1467.33
    [20] Савина С.В. и др. 2020. Применение телекоммуникационных технологий в управлении территориями. Журнал экологического менеджмента и туризма, 11 (5): 1143-1151. DOI: https: //doi.org/10.14505//jemt.v11.5 (45) .12
    [21] Ван Винден, В. 2008. Городское управление в экономике, основанной на знаниях: проблемы для разных типов городов. Инновации: управление, политика и практика, 10 (2-3): 197-210.
    [22] Зигиарис, С. 2011. Эталонная модель умного города: помощь планировщикам в концептуальном построении инновационных экосистем умного города.Журнал экономики знаний, 4 (2): 217–231.
    [23] Рио + 20. 2012. Конференция Организации Объединенных Наций по устойчивому развитию. Будущее, которого мы хотим, 20-22 июня 2012 года, Рио-де-Жанейро, Бразилия. Доступно на: https://www.un.org/ru/events/pastevents/pdf/brochure_rio.pdf.

    Наша команда — Новости налогов и таможни России

    Свяжитесь с нами, чтобы узнать, чем мы можем вам помочь [email protected]

    ДЖАНГАР ДЖАЛЬЧИНОВ

    Телефон: +7 495 644 05 00 Напишите мне

    Джангар — партнер московского офиса Dentons и руководитель налоговой и таможенной практики в России.В первую очередь он занимается налоговыми спорами. В период с 2007 по 2018 год Джангар рассмотрел более 1000 судебных дел, в том числе в Высшем арбитражном суде. Кроме того, он оказал полное сопровождение в значительном количестве налоговых споров, урегулированных на досудебной стадии. Джангар также консультирует по различным аспектам налогообложения, включая разработку внутренней политики по предотвращению налоговых рисков (в отношении поставщиков, маркетинга и др.), Анализ контрактов на предмет налоговых рисков и проверку налогового учета для выявления потенциальных налоговых начислений и переплат.

    БОРИС БРУК

    Напишите мне

    Борис Брук — советник московского офиса Dentons. Он специализируется на общем корпоративном и международном налоговом праве и имеет значительный опыт консультирования по налоговым аспектам корпоративной реструктуризации. В частности, Борис консультирует клиентов по вопросам налогового структурирования в связи с финансированием совместных предприятий в России, трансграничных сделок, а также входящих и исходящих инвестиций. Его работа заключалась в разработке эффективных с точки зрения налогообложения индивидуальных и корпоративных холдинговых структур, а также в структурировании финансирования и деятельности по владению интеллектуальной собственностью, а также в консультировании по вопросам снижения выявленных налоговых рисков.В прошлом Борис также консультировал по вопросам налогообложения в связи с IPO.

    ГАЛИНА ДОНЦОВА

    Напишите мне

    Галина возглавляет группу таможенного права в налоговой и таможенной практике Российской Федерации. Имеет более чем 20-летний опыт консультирования по всем аспектам таможенного регулирования, включая аудит внешнеторговых и таможенных операций участников ВЭД; помощь в прохождении таможенного досмотра; структурирование импортно-экспортных сделок; юридическая экспертиза и рекомендации по составлению внешнеторговых контрактов и контрактов с поставщиками таможенных услуг; консультирование по вопросам классификации товаров, таможенной стоимости, страны происхождения, использования различных таможенных процедур и таможенных льгот; переговоры с таможенными органами различного уровня; обжалование решений таможенных органов, сопровождение сделок по ввозу оборудования, оказание участникам ВЭД практической помощи в оформлении документов для таможенного оформления и других вопросах таможенного регулирования.

    ВАЛЕНТИН ЛАРИН

    Напишите мне

    Валентин — советник российской налоговой и таможенной практики Dentons. Он специализируется на консультировании по российскому налоговому праву, а также на представлении компаний в сложных налоговых спорах. Валентин участвует в проектах, которые охватывают налоговые аспекты таких сфер, как строительство и девелопмент, телекоммуникации, розничная торговля, автомобилестроение, фармацевтика и другие. До прихода в Dentons Валентин участвовал в проектах по налоговому аудиту и налоговой экспертизе.

    АЛЕКСЕЙ МАТВЕЕВ

    Напишите мне

    Алексей Матвеев — советник российской налоговой и таможенной практики Dentons. Алексей специализируется на консультировании по международному и российскому налоговому праву. Обладает обширным опытом консультирования по вопросам организации и проведения налоговой проверки объекта сделки с учетом возможных конкретных производственных / операционных рисков, разработки предложений по структурированию сделок (включая иностранные юрисдикции), анализа налоговых последствий договоров купли-продажи. и разработка предложений по проведению корпоративной реструктуризации цели, а также анализ правильности налоговых допущений финансовых моделей транзакций.

    АННА ЗВЕРЕВА

    Напишите мне

    Анна Зверева — советник российской налоговой и таможенной практики Dentons. В частности, она специализируется на налоговом консультировании промышленных предприятий, торговых организаций и компаний, специализирующихся на интеллектуальной собственности, а также международных групп (НДС, налог на прибыль, включая вопросы налогового учета, налоги на заработную плату, региональные и местные налоги и применение соглашений об избежании двойного налогообложения. ). Реализует проекты, связанные с налоговыми аспектами реструктуризации бизнеса в Российской Федерации; налоговое консультирование по всем видам сделок, включая сделки купли-продажи бизнеса; Налоговая экспертиза; подготовка предложений по изменению налогового законодательства; и консультирование по вопросам ведения бухгалтерского учета в соответствии с российскими стандартами бухгалтерского учета.


    КИДРЯЕВА НАТАЛЬЯ

    Наталья Кидряева — старший юрист налоговой и таможенной практики Dentons в России. Наталья специализируется на таможенном консультировании международных и российских компаний, а именно: таможенный аудит, таможенное структурирование импортно-экспортной деятельности, общение с таможенными органами (составление заявлений и обращений, подготовка презентаций для обсуждения с таможенными органами и т. Д.), Консультирование по вопросам таможенная оценка и классификация товаров, консультирование таможни по конкретным сделкам и консультирование по ограничениям и запретам на импорт / экспорт (лицензирование, сертификация, экспортный контроль).

    НИКОЛАЙ РУДОМАНОВ

    Николай Рудоманов — старший юрист российской налоговой и таможенной практики Dentons. Он специализируется на международном корпоративном и индивидуальном налогообложении. Николай имеет значительный опыт консультирования крупных российских и международных компаний в промышленном и финансовом секторах, сопровождения международных налоговых проверок и консультирования семейных офисов и частных клиентов по вопросам структурирования их владения активами в различных юрисдикциях.

    КРИСТИНА БАЛЕВА

    Кристина Балева — юрист российской налоговой и таможенной практики Dentons.Кристина специализируется на консультировании российских и международных компаний по вопросам таможенного регулирования, а именно, анализу будущих сделок и контрактов (как заключенных, так и находящихся в процессе заключения) на предмет возможных таможенных рисков, а также эффективного использования допустимых таможенных инструментов, подготовки рекомендаций о том, как применять таможенные процедуры (временный ввоз, переработка на таможенной территории / вне таможенной территории, таможенный склад, таможенный транзит и др.), меры таможенно-тарифного и нетарифного регулирования внешней торговли, содействие в оспаривании решений таможенных органов (таможенная стоимость , классификационный код) и при получении предварительных решений о классификации товаров.

    АННА КНЕЛЬЗ

    Анна Кнельц — юрист российской налоговой и таможенной практики Dentons. Анна специализируется на представлении интересов клиентов в налоговых спорах, помощи в проведении налоговых проверок в офисе и на выезде, а также на консультировании по российскому налоговому законодательству. Анна имеет опыт консультирования российских и международных компаний по вопросам налогообложения, налогообложения иностранных инвестиций и налогового структурирования сделок. До прихода в Dentons Анна также участвовала в проектах, касающихся применения правил CFC, налогового и валютного резидентства.


    МАРИЯ КОЧУБЕЙ

    Мария — юрист российской налоговой и таможенной практики Dentons. Она специализируется на международном трансфертном ценообразовании, в частности, на анализе и разработке трехуровневой структуры отчетности о трансфертном ценообразовании. Ее опыт включает проекты по (1) подготовке мастер-файла для компаний, представленных в более чем 30 странах, (2) локальных файлов для России, США, ЕС и стран Юго-Восточной Азии, а также отчетов по странам (CbCR). согласно правилам, действующим в России и США.

    АНТОН НОВАК

    Антон — юрист российской налоговой и таможенной практики Dentons. Он специализируется на консультировании международных и российских компаний розничной торговли, производства потребительских товаров и промышленного производства по вопросам корпоративного налогообложения. Он участвовал в проектах по обязательному и добровольному аудиту компаний, в которых он также анализировал международные аспекты налогообложения и налоговые последствия внутригрупповых операций. Антон также имеет опыт досудебного обжалования решений налоговых органов.

    АЛИСА ПЕНДЮРИНА

    Напишите мне

    Алиса специализируется на трансфертном ценообразовании. Имеет обширный опыт работы с проектами по разработке методологий трансфертного ценообразования и подготовке документации, подтверждающей соответствие рыночной цены в различных типах сделок (включая сделки внутри России и сделки по торговле внешними товарами и услугами, внутригрупповое финансирование, заимствования, внесение депозитов, предоставление прав на использование нематериальных активов). активы и т. д.). Также она имеет опыт выявления существующих рисков трансфертного ценообразования и разработки предложений по их минимизации, в том числе с использованием механизма независимых и симметричных корректировок. Она занималась подготовкой отчетов по странам, включая местные файлы и мастер-файлы.

    ОЛЬГА ПОЛОВЦЕВА

    Напишите мне

    Ольга Половцева — руководитель группы налогового учета налоговой и таможенной практики Dentons в России. Ольга специализируется на консультировании по общим вопросам российского налогового законодательства и ведению бухгалтерского учета представительств иностранных компаний в Российской Федерации, подготовке налоговых и иных отчетов для юридических и физических лиц.Она имеет значительный опыт консультирования крупных российских и международных компаний по широкому кругу вопросов применения налогового законодательства, практический опыт оказания помощи клиентам в проведении камеральных и выездных налоговых проверок, а также представление интересов клиентов, в том числе укрепление их позиции, в сложных налоговых спорах.

    ИРИНА КУРГИНА

    Напишите мне

    Ирина Кургина — специалист группы налогового учета налоговой и таможенной практики Dentons в России. Она специализируется на консультировании по общим вопросам российского налогового права и налогового учета.Ирина имеет опыт консультирования крупных российских и международных компаний по широкому кругу вопросов применения налогового законодательства и ведения налогового учета для представительств иностранных компаний в России. Также Ирина имеет опыт подготовки налоговых и иных деклараций для юридических и физических лиц. Ее опыт включает успешное представление клиентов в камеральных и выездных налоговых проверках.

    ИВАН КОРЕШКОВ

    Напишите мне

    Иван — юрист российской налоговой и таможенной практики Dentons.Он специализируется на международном налоговом праве, российском налоговом праве и сделках M&A. Ранее Иван проходил стажировку в «Пепеляев Групп», работал юристом в Alstom Atomenergomash и занимал должность помощника юриста в департаменте интеллектуальной собственности в Atomenergomash.

    АНДРЕЙ ГУЛЯ

    Напишите мне

    Андрей — помощник юриста в российской налоговой и таможенной практике Dentons. Он специализируется на российском налоговом праве и судебных спорах. Ранее Андрей работал в юридической фирме «Деловой фарватер» помощником юриста и юристом.

    ЛИДИЯ ЧАРИКОВА

    Напишите мне

    Лидия имеет более чем 15-летний опыт консультирования по вопросам внутреннего и международного налогообложения в различных секторах экономики, а также практический опыт представления интересов налогоплательщиков в судебных спорах с налоговыми органами. Ее основные направления — международное налоговое структурирование; частное богатство; налоговое сопровождение проектов частно-государственного партнерства, проектов на рынках капитала и сделок M&A; и сопровождение налоговых споров.Лидия была признана ведущим налоговым юристом такими международными изданиями, как Chambers Europe, The Legal 500 и Best Lawyers.

    ОКСАНА ГОНЧАРОВА

    Напишите мне

    Оксана — юрист налоговой и таможенной практики Denton. Она специализируется на консультировании российских и иностранных клиентов по российскому налоговому законодательству (в том числе по вопросам бенефициарного владения, правил недостаточной капитализации и налогообложения контролируемых иностранных компаний (КИК)) в связи с созданием холдинговых структур, структур внутригруппового финансирования и совместных предприятий.Оксана также имеет опыт налогового сопровождения финансовых операций (выпуск еврооблигаций и секьюритизация) и проектов в нефтяной и нефтеперерабатывающей отраслях.

    АЛИНА ИВАНОВА

    Напишите мне

    Алина — помощник юриста в российской налоговой и таможенной практике Dentons.

    Россия | International Tax Review

    Денис Щекин

    Щекин и партнеры

    Нижний Кисловский переулок, 6, корп 2
    125009 Москва
    Россия

    Тел .: +7 495 984-63-01
    Электронная почта: info @ schekinlaw.ru
    Веб-сайт: www.schekinlaw.ru

    Денис Щекин — управляющий партнер компании «Щекин и партнеры» в Москве.

    Он занимается налоговыми спорами и сопровождением налоговых проверок, налоговым структурированием и оценкой рисков, а также трансфертным ценообразованием. Денис специализируется на налоговом праве, включая налоговые споры и налоговое консультирование.

    Денис консультировал компании и занимался налоговыми спорами с 1995 года. Он представлял российских и международных клиентов в суде, оспаривая дополнительные налоговые начисления на сотни миллиардов рублей.

    Согласно рейтингам Best Lawyers , Chambers Europe , Global Legal Experts , Tax Director Handbook , European Legal Experts и другим, Денис входит в число ведущих российских налоговых специалистов.

    Денис — автор книг и публикаций по налогам и один из самых ярких спикеров по налоговой тематике.

    Денис окончил юридический факультет Красноярского государственного университета в 1997 году, а в 2001 году стал кандидатом юридических наук.Денис также является членом Федеральной палаты адвокатов Российской Федерации.

    «Щекин и партнеры» специализируется на налоговом, коммерческом праве и различных видах судебных споров, предоставляя первоклассные услуги с глубокими знаниями и богатым опытом. Фирма предлагает юридические консультации ведущим российским и международным предприятиям в нефтегазовой, металлургической, пищевой, автомобильной, строительной, транспортной, ИТ, банковской, оптовой и розничной торговле и других отраслях. Специалисты «Щекин и партнеры» проходят тщательную программу профессионального обучения, читают все ключевые публикации по налоговому, гражданскому праву, судебным решениям и официальным рекомендациям.Фирма использует свои налаженные связи с ведущими российскими университетами для получения экспертных заключений по самым сложным проблемам, связанным с любой отраслью права.

    Leave a Reply

    Ваш адрес email не будет опубликован.