7Д окрашивание: 7д окрашивание волос фото до и после (30 фото)

Содержание

Окрашивание волос 3d (д) и 7д 2017

В моде всегда была, есть и будет естественность. Профессиональные стилисты и колористы, утверждают, что обыкновенный процесс окрашивания не принесет должного результата, а именно, эффектность, яркость, объемность, живость и свежесть. Поэтому, сегодня, наибольшую популярность получило окрашивание волос 3d (д), которое помимо перечисленных эффектов, дает еще и естественный перелив цвета.

3д окрашивание волос — почему стоит попробовать

Объемное окрашивание волос 3d (д) предлагает огромную цветовую палитру и многочисленные насыщенные оттенки. Такие инструменты делают переливы цвета волос естественными, гармоничными и плавными. С такой методикой игры цветов локоны не будут выглядеть броско или отстраненно.

Получается, что такое окрас может выбрать любая девушка. Но, есть один нюанс. Цветовая палитра для темных волос имеет расширенный характер. Но, дамы со светлыми волосами, не падайте в отчаяние, окрашивание волос 3d (д) тоже придаст Вашим локонам натуральный и блистательный вид, в случае правильно подобранной палитры оттенков.


Не стоит путать объемное окрашивание волос с техникой колорирования. При втором виде процедуры, мастер волен двигаться в любом направлении и комбинировать любые цвета. Окрашивание волос 3d (д) использует только одну цветовую палитру и работает только с теми оттенками, которые в нее входят.


Благодаря хорошо подобранной цветовой палитре и вариациями входящих оттенков, профессионал с легкостью получает многогранный и натуральный эффект. Как уже понятно из статьи, натуральность – это главная цель любой процедуры.

Преимущества 3d окрашивания

Процедура 3d (д) окрашивание безопасна и экологична. Не портит структуру волос и здоровье. Также, постоянная коррекция не потребуется, так как волосы хорошо обработаны пошаговой техникой. Подобранный цвет выглядит ярко, живо и натурально, поэтому отросшие корни вовсе не будут бросаться в глаза.
Стоит обратить внимание, что процедуры мелирования, обесцвечивания и прочие обыкновенные способы наносят вред прядям. Окрашивание волос 3d (д) было изобретено из гуманного отношения к прядям, и подразумевает выбор природных и натуральных оттенков.


Ответ на заголовок статьи получен, далее стоит понять саму технологию окрашивания волос 3d (д).

Объемное окрашивание волос 3d — техника выполнения

Давайте разберемся, каким же способом можно получить все вышеперечисленные эффекты. Технология разбивается на пошаговые действия.

1. Выбор цвета. Для начала мастер подбирает наиболее подходящий цвет.

2. Выбор оттенка. Из предоставленной палитры основного цвета, выбирается один основной оттенок и несколько дополнительных. Как правило, они на 1 -2 тона светлее главного.
Дополнительные оттенки были выбраны для нескольких прядей. С помощью их обработки, общий вид картины дополнится красивыми и естественными переливами волос. Для наглядной демонстрации, можно обратиться к фото «до и после» и рассмотреть все преимущества такой технологии. Но, запомните, ни одна картинка не способна полностью передать живые краски и игру цвета.


Корни, при системе 3d окрашивания поддаются более темному оттенку, потому что именно такая кондиция позволит цветомодифицированным локонам выглядеть натурально и лаконично.

Схема 3d окрашивания

Схема имеет стандартный и наработанный вид. Поэтому, при окрасе следует строго ей следовать.

1. Сначала прокрашивается затылочная часть, начиная с треугольной области (см. рисунок). Как было указано выше, что мастер выбирает несколько оттенков. Так вот, в данном случае, будет использован основной. Далее берем от его основ пряди, толщиной 1,5 – 2 см, прокрашивая их в светлые, выбранные оттенки.

2. Мастер, подбираясь к нижней затылочной зоне, красит в последовательности:
• Оттенок светлее на тон;
• Оттенок светлее на пол тона;
• Оттенок темнее на пол тона;
Соответственно, данные три оттенка были выбраны отталкиваясь от главного (основного) цвета. Зоны, показанные на рисунке под номерами 2, 1 и 3 красятся по тому же принципу.

3. Такая последовательность длится до самой височной зоны (см. номер 5 на рисунке). Тут остановимся и обратим внимание на прядь, которая находится у лица. Вот эти 2 см волос прокрашиваются именно в основной оттенок. Затем цепляем пряди по 1,5 см и красим аналогично затылку.

4. Теменная часть уходит в работу в последней очереди (номер 4 на рисунке). Прокрашивается она по аналогичной последовательности оттенков.

7д окрашивание волос

3д окрашивание волос – это достаточно новая технология, появившееся в парикмахерском искусстве. Но, мир красоты постоянно находится в движении, преподнося новые и новые процедуры. Окрашивание волос 7д стало сильным конкурентом техники 3д. В чем новшество?
А в том, что окрас происходит в горизонтальном направлении от роста волос. Техника использует большую палитру, поэтому имеет больший диапазон движения. Она смотрится ярко и натурально. Для наглядного сравнения двух технологий, можно посмотреть различные фото, демонстрирующие результат. То есть, 3d окрашивание использует один цвет и несколько оттенков, а процедура 7d производит покраску волос разными цветами.


На вопрос: почему стоит попробовать данную процедуру, был предоставлен развёрнутый ответ.

3д окрашивание волос — фото

Объемное окрашивание волос постепенно набирает обороты и своих постоянных клиентов. Ведь такая технология, действительно, делает волосы более живыми и натуральными. А в мире постоянных напряжений и неблагоприятной экологической ситуации, пряди теряют все здоровые свойства и привлекательный вид.

Также, благодаря статье, Вы уже немного представляете инновационную технологию окрашивания. Теперь, при точном решении, необходимо грамотно подобрать опытного мастера, который не только имеет глобальный стаж, но и может «чувствовать» цвет. Таких действительно мало, но, кто ищет, тот всегда найдет!
В домашних условиях, не рекомендуется проводить окрашивание по системе 3d. Даже описанная схема может не принести должного эффекта. Такое дело должно всегда находиться в руках у профессионалов.

ТОП-4 современных техник мелирования

Мелирование - это самый дорогой и известный метод окрашивания волос. Мелирование помогает женщинам быть уникальной и неповторимой, создавая элегантный образ, подчеркивая их натуру. Время не стоит, и наши бьюти специалисты стремятся разнообразить техники, делая более натуральный и естественный образ. Существует огромное количество видов мелирования, главное подобрать цвет и технику по цветотипу лица.


Какие же современные техники мелирования?

Балаяж

Балаяж - это техника мелирования, которая появилась во Франции в 70-е годы. Волосы выглядят, как после солнечных ванн, создавая блики на волосах, подходит это техника для всех типов и структур волос, так как повреждение относительно не сильное. Как же выполняется техника балаяж? Осветлитель наноситься на отдельные пряди кистью и растушевывается, чтобы волосы не путались пряди разделают фольгой, но не закрывают.

Шатуш

Шатуш - это разновидность мелирования. Выполняется начес отдельной пряди и оставшиеся волосы осветляют. Затем тонируют в один или несколько тонов отдельные осветленные остатки волос от начеса.

Аир Тач

Аир Тач - до словно переводится "прикосновение воздуха". Эта техника дает наиболее естественный результат. Волосы распределяются по проборам, пряди обдуваются феном под определенным углом оставляя 30-50% от волос, осветляются под фольгой и затем тонируются.

Классическое мелирование

Классическое мелирование - это когда берут прядь волос, объем зависит от желаемого конечного результата, начинают осветлять от корней и по всей длине волос. Тонирование осветленных прядей выбирают по желанию клиента. Подходит этот метод мелирования любой девушке и женщине.

Какие современные виды мелирования есть?

Бэйбилайтс - этот вид мелирования, представляет собой техники балаяжа и мелирования. Эффект выгоревших волос, делают акцент возле лица, на концах волос.

Омбре - этот вид мелирования, всем известен, и он конечно не отразим и интересен. Многие путают его с техникой мелирования, но это именно вид. Омбре - это когда на волосах делают плавный переход от темного к светлому, либо наоборот. Сейчас тенденции в моде создаёт естественность, но для дерзких и креативных особ, можно выбрать яркие оттенки: розовый, синий, зеленый, фиолетовый.

Брондирование - этот вид мелирования, представляет собой многоярусное окрашивание, создает игру красок и блеск на волосах. Существуют виды брондирования: классическое, деграде (темные корни переходят в светлые концы), зональное, калифорнийское (эффект выгоревших волос именно для брюнеток), бразильское(к калифорнийскому виду добавляются больше цветов).

Peek-a-Boo в этом виде мелирования, используют яркие и темные оттенки, именно на кончиках волос любой стрижки. Такой вид мелирования выбирают самые смелые девушки.

Уход за волосами после мелирования

Чтобы осветленные волосы выглядели, ухоженными и блестящими, необходим каждодневный домашний уход. Домашний уход должен состоять из профессиональных средств, которые можно приобрести только в салонах красоты, либо в профессиональных магазинах. По типу волос и кожи головы, подбираем шампунь, затем маску смываемую для волос, несмываемый уход, это может быть эссенции, масло, молочко. Обязательно несмываемый уход должен быть термозащитным, так как осветленные волосы и так были подтверждены химическому воздействию.

Кроме того обязательно раз в месяц ходить в салон красоты для профессионального ухода за волосами. Специалист подберет необходимый индивидуальный уход, в зависимости от состояния волос.

Навальные волосы красить 3д | прически и стрижки

Автор Светлана Васнецова На чтение 5 мин. Просмотров 666 Опубликовано Обновлено

Мода всегда была, есть и будет естественным. Профессиональные стилисты и колористы утверждают, что обычный процесс окрашивания будет производить желаемого результата, а именно, эффективность, яркость, громкость, живость и свежесть. Итак, сегодня, наиболее популярными являются волосы окраска 3д (D) в дополнение к этим эффектам, дает ровный и естественный перелив цвета.

3D цвет волос — Почему нужно попробовать

Основная окраска волос 3д (д) предлагается огромная цветовая палитра и несколько богатых оттенков. Такие инструменты делают игру цвета волос-это естественный, гармоничный и мягкий. Такой метод игры цвета завитки не будут смотреться безвкусно или отдельно.

Получается, что этот цвет может быть выбирает любую девушку. Но есть один нюанс. Цветовая палитра для темных волос имеет расширенный характер. Но, дамы со светлыми волосами, не стоит впадать в отчаяние, окраска волос 3д (D) также подарит вашим локонам естественный и блестящий внешний вид, в случае правильно подобранной палитры цветов.
Не путайте объем окрашивание волос окрашивание в технике. Во второй процедуре мастер может свободно перемещаться в любом направлении и комбинировать любые цвета. Окраска волос 3д (D) использует только одну цветовую палитру и работать только с теми оттенками, которые он содержит.

Благодаря хорошо подобранной цветовой палитре и вариации входящего тона, профессионал легко получает универсальный и естественный эффект. Как явствует из статьи, естественность-это главная цель любой процедуры.

Преимущества 3D цвет

Процедуры 3D (д) окрашивание безопасным и экологически чистым. Не портят структуру волос и здоровья. Кроме того, постоянная коррекция не требуется, так как волосы хорошо продуманной пошаговую инструкцию техника. Выбранный цвет выглядит ярким, живым и естественным, поэтому корни не будут бросаться в глаза.
Следует обратить внимание, что процедуры окрашивания, обесцвечивания и других обычных способов повредить пряди. Окраска волос 3д (D) был изобретен из гуманного отношения к пряди, и включает в себя выбор натуральных и естественных оттенков.
Ответ на название статьи получается, тогда надо разбираться в технологии окрашивания волос 3д (д).

Основная окраска волос 3д техника

Давайте посмотрим, каким же способом можно получить все вышеперечисленные эффекты. Технология разбита на пошаговые действия.

1. Выбор цвета. Для начала мастер выбирает наиболее подходящий цвет.

2. Выбор цвета. Из представленной первичной палитру цвета, выбрать один основной цвет и несколько дополнительных. Обычно они от 1 до 2 тонов светлее, чем основной.
Дополнительные оттенки выбраны для нескольких нитей. С помощью их обработки, общий вид картины будут дополнять красивые и натуральные оттенки волос. Для иллюстрации, можно применить к фотографиям до и после и рассмотреть все преимущества этой технологии. Но помните, никакая фотография не способна полностью передать цвет и игру цвета.

Корни, когда система 3D цвет придают более темный оттенок, потому что это условие позволит tsvetomuzykalnym локоны выглядят естественно и просто.

Схема 3D окрашивания

Схема имеет стандартный и устоявшийся облик. Следовательно, цвет должен строго следовать ему.

1. Сначала окрашивали спину, начиная с треугольной области (см. рисунок). Как уже упоминалось выше, мастер выбирает несколько оттенков. Так, в этом случае, будет использоваться главным. Затем возьмите из его нитей основы, толщиной 1,5 – 2 см, прогресива их в свете выбранного цвета.

2. Мастер, приступая к нижней части затылочной области, краски в последовательности:
• Тени более светлого тона;
• Оттенок светлее, на пол тона;
• Оттенок темнее, на пол тона;
Соответственно, эти три оттенка были выбраны начиная от основных (первичных) цветов. Зоны показаны на рис. 2, 1 и 3 окрашены тот же принцип.

3. Эта последовательность продолжается до височных областей (см. № 5 на рисунке). Затем остановиться и обратить внимание на нить, которая является человеком. Эти 2 см волос окрашенных в основной актерский состав. Затем прикасается к пряди до 1,5 см и цвета, похожими на затылке.

4. Теменная часть переходит в работу на последнем этапе (номер 4 на рисунке). Окрашивали его в той же последовательности цветов.

7Д окрашивание волос

3Д окрашивание волос-это довольно новая технология, которая появилось в парикмахерском искусстве. Но, мир красоты постоянно находится в движении, представляя новые процедуры. Окрашивание волос 7Д стала сильным конкурентом 3D-технологии. Что такое инновации?
И этот цвет происходит в горизонтальном направлении от роста волос. Методика использует большую палитру, поэтому он имеет большой диапазон движения. Она выглядит ярко и естественно. При визуальном сравнении двух технологий, вы можете увидеть различные картинки, показывающие результат. Я имею в виду, 3D картина использует один цвет и несколько оттенков, и процедура 7Д производит окрашивание волос в разные цвета.

На вопрос: почему вы должны попробовать эту процедуру, предоставили подробный ответ.

3D окрашивания волос фото

Основная окраска волос набирает обороты и своих постоянных клиентов. Потому что эта технология действительно делает волосы более живыми и естественными. И в мире, где постоянные стрессы и неблагоприятная экологическая ситуация, пряди теряют свои полезные свойства и привлекательный внешний вид.

Кроме того, благодаря статье, вы уже представит инновационную технологию окраски. Теперь, с точным решением, необходимо грамотно подобрать квалифицированных мастеров, которые не только мировой опыт, но также может “чувствовать” цвет. Там действительно не хватает, но, кто ищет, тот всегда найдет!
Дома не рекомендуется для окрашивания в 3D. Даже эта схема может не принести желаемого эффекта. Такая вещь всегда должна быть в руках профессионалов.

  • Об авторе
  • Хотите связаться со мной?

Я парикмахер, кто не знает – это специалист в области создания стиля волос с помощью причёски и парика. Теперь с помощью этого сайта я смогу поделиться с вами оригинальными прическами. Присоединяйтесь! Ваши волосы в надежных руках.

Технологии окрашивания волос.. Статьи компании «ООО "Профи Стиль"»

Одним из самых простых, доступных и популярных способов смены имиджа считается окрашивание волос.

Технологии окрашивания волос.

Вы узнаете:

  • Какие средства для окрашивания волос существуют.
  • Что нужно знать о первичном и вторичном окрашивании волос.
  • Какие выделяют основные технологии окрашивания волос.
  • Как окрашивать волосы в один тон.
  • Как производить окрашивание волос тон в тон.
  • Какие есть сложные технологии окрашивания волос.
  • Что такое блочное и 3D-окрашивание волос.
  • Как окрашивать волосы в контурной технике.
  • Что нужно знать о мужском мелировании.
  • Какими будут новые технологии окрашивания волос в 2018 году.
  • Выбор средства как основа любой технологии окрашивания волос
  • Выбор нужной технологии окрашивания и красящих средств зависит от желаемого результата.

 

Выбор средства как основа любой технологии окрашивания волос

Любое использование материалов допускается только при наличии гиперссылки.

Препараты классифицируются на группы по методу воздействия на волосы:

1. Временные (уровень 0) – используются для временной смены цвета или при окраске нескольких прядок. Выпускаются в виде порошка, мусса или туши. Их преимущества: большое количество оттенков и простота нанесения. К недостаткам относятся нестойкость полученного цвета и невозможность окрасить очень темные волосы в желаемый цвет.

2. Нестойкие красители (уровень 1) – без аммиака и перекиси водорода. Полученный результат выдерживает до восьми процедур мытья головы с использованием шампуня. Оказывают щадящее воздействие, могут применяться на слабых волосах – это их преимущества. А недостатки следующие: не гарантировано закрашивание седых волос; небольшое количество оттенков; невозможно окрашивание темных волос в светлые тона. Выпускаются в виде тоников, оттеночных шампуней и бальзамов.

3. Полустойкие (уровень 2) – содержат перекись водорода, с их помощью можно осветлить или сделать волосы темными. Их достоинства: в составе совсем нет (или есть минимальное количество) аммиака, закрашивают седину и позволяют кардинально поменять цвет. Однако у них имеются и недостатки – такие препараты не смогут окрасить волосы, которые ранее подвергались воздействию аммиачными красителями. Кроме того, в тех случаях, когда седые волосы составляют более половины объема, остается не полностью прокрашенная седина.

4. Стойкие (уровень 3) – c их помощью получают стойкое окрашивание волос, в том числе и седых. Для щадящего воздействия на волосы они содержат масла. Их преимущества: позволяют обесцветить волосы без предварительной подготовки до четырех тонов, имеют широкий спектр оттенков и гарантируют полное закрашивание седины. К недостаткам можно отнести отрицательное воздействие составляющих веществ (перекись водорода, аммиак) на состояние волос, резкий неприятный запах при окрашивании, противопоказания к применению (например, беременным и кормящим женщинам) из-за проникновения вредных компонентов через кожу.

Принятие решения о смене цвета волос довольно ответственное, поэтому необходимо серьезно подойти к выбору наиболее подходящего красителя. Наращивание волос – процедура, которая всегда будет приносить прибыль               

3 основных правила выбора краски для волос

Правило №1. Не следует игнорировать отзывы потребителей, они обязательны к прочтению. Довольно часто на специальных сайтах и тематических форумах мастеров размещается достоверная информация о различных красителях, дополненная фотографиями, подтверждающими их безопасность для здоровья волос.

Правило №2. Следует найти в интернете сведения о красителях, для этого можно посетить официальные сайты компаний, выпускающих краску для волос.

Правило №3. Выбирая в специализированном магазине краситель для волос, необходимо тщательно рассмотреть упаковку: коробочка должна быть целой и невредимой, с четко напечатанной информацией о товаре (в том числе датой выпуска и сроком годности). Внимательно ознакомьтесь с составом – в краске, обозначенной, как органическая, натуральные вещества должны находиться в самом начале списка.

 

Технологии первичного и вторичного окрашивания волос

1. Первичное окрашивание волос Технология первичного окрашивания волос, которые не подвергались воздействию химических или натуральных красок, имеет свои особенности. Нанесение красящего состава сразу же на корни – главная ошибка. На натуральные (не забитые другими пигментами) волосы краску сначала наносят, отступив 2-5 см от корней, и только потом – на корни. Это необходимо для того, чтобы волосы у основания не выглядели слишком яркими и неестественными (так называемые, «горящие корни»). При окраске волос в красно-желтые оттенки такой эффект особенно бросается в глаза, но и русый цвет в подобных случаях также непредсказуем. Исправлять нежелательный результат придется путем дополнительного окрашивания.

2. Вторичное окрашивание волос В тех случаях, когда требуется только «освежить» или подкорректировать цвет ранее окрашенных волос, применяется вторичное окрашивание волос – это другая схема нанесения красящего состава. Сначала краску наносят на корни, выдерживают 15-20 минут, «растягивают» по всей длине и оставляют на такое же время воздействия. Затем делают «взбивание» краски водой – слегка смачивают волосы, «взбивают» их (как при мытье с использованием шампуня). Через 5-10 минут тщательно смывают красящий состав. Чтобы получать желаемые оттенки, нужно знать правила смешивания. Готовая краска – это смесь нескольких пигментов, проникающих в волосы. При дальнейшем окрашивании они могут вступать между собой в непредсказуемые реакции и окрашивать волосы в, мягко говоря, «неожиданные» цвета – голубой, зеленый и т. п. Для предотвращения подобного эффекта профессионалы добавляют в красящий состав микстоны.

 

Основные технологии окрашивания волос

Качество прически напрямую зависит от примененной технологии окрашивания волос. Существует несколько вариантов окраски:

Традиционное – волосы приобретают одинаковый оттенок от корней до самых кончиков.

Мелирование – окрашивание в более светлый оттенок нескольких прядей разной толщины, каждая из которых красится отдельно и заворачивается в фольгу. В результате получается особенный эффект. Выполняется мелирование (выбор зависит от структуры и типа волос) через шапочку, с начесом, на хвостах или на косе.

Колорирование – придание отдельным прядям разных оттенков. Необходимо подбирать цвета, гармонирующие между собой и с натуральным цветом волос. Могут отличаться и сами варианты мелирования. Например, берут оттенки краски разного уровня и производят растяжку от темных корней до светлых кончиков – брондирование или шатуш. На коротких стрижках бесподобно смотрятся осветленные по технике балаяж кончики волос.

Техники выполняются с использованием минимального количества средств и не требуют больших материальных затрат. Чтобы не нанести вред волосам, если структура не позволяет применить окрашивание, мастер обязательно сообщает об этом клиенту. Очень популярна техника брондирование волос в стиле «омбре». В этом случае корни остаются более темными, мелирование начинается от середины роста волос к их кончикам. Разновидностью такого мелирования является техника «сомбре» – здесь едва заметна разница между оттенками.

 

8 советов по выбору цвета, чтобы окрашивание волос, технология выполнения и конечный результат восхитил клиента

Совет №1. Синевато-голубые глаза идеально гармонируют с рыжими, светло-каштановыми и темно-карамельными волосами.

Совет №2. Серо-голубые глаза прекрасно смотрятся с волосами цвета теплого каштана и пепельными. Рекомендуется также и темно-русый оттенок.

Совет №3. К зеленым глазам, радужная оболочка которых приближается к цвету ореха, подходят темно-русый, каштановый и светло-коричневый тона.

Совет №4. Изумрудно-зеленые глаза прекрасно сочетаются с бронзовыми, медными и рыжими волосами. Также подойдут золотистые и каштановые оттенки.

Совет №5. Девушкам со светлой кожей и карими глазами можно рекомендовать медные, карамельные и шоколадные тона.

Совет №6. Кареглазым смуглянкам прекрасно подойдут темные, почти черные оттенки.

Совет №7. С рыжими волосами отлично сочетаются светло-карие глаза.

Совет №8. Девушки с серыми глазами могут окрашивать волосы в разные оттенки, им только следует исключить черный, иссиня-черный и цвет темного каштана.

 

Технология окрашивания волос тон в тон

Сейчас растет популярность технологии окрашивания волос тон в тон, предполагающая изменение цвета не более чем на 1-2 тона. При выполнении окраски волос по такой технологии отлично закрашиваются корни седых волос, а их основная масса выглядит блестящей и яркой. Стойкость полученного цвета зависит от качества используемой краски. Если волосы моют не чаще двух раз в неделю, результат сохраняется в среднем в течение трех месяцев. Технология окрашивания волос тон в тон, скорее всего не подойдет женщинам, имеющим очень седые волосы, – в таких случаях нужно принимать более кардинальные меры. При окраске волос тон в тон не нарушается натуральная пигментация, то есть полностью сохраняются структура волос и естественный цвет. Технология окрашивания волос тон в тон используется для того, чтобы «освежить», придать волосам естественный вид или создать более эффектный цвет. На некоторых типах волос такое окрашивание похоже на колорирование – прядям придают яркие сияющие тона, оттеняющие красоту натурального цвета. Например, каштановые волосы приобретают бронзовый блеск, а светлые начинают переливаться янтарно-медовыми оттенками. До использования технологии тон в тон необходимо принять меры по улучшению структуры волос, чтобы они стали более послушными, эластичными и держали цветовое покрытие. Для этого перед окраской на волосы наносится специальная питательная смесь, которая их разглаживает, делает более ухоженными и «упитанными». Такая «подкормка», в отличие от масок, остается на волосах до полного впитывания – не смывается. Если волосы пористые, питательная смесь заполнит пустоты, а секущиеся и сухие «накормит» нужными кислотами. Как правило, в такие составы входит магний и витамин Е, которые способствуют более равномерному окрашиванию и повышению стойкости цвета. Использование подобных смесей позволяет значительно продлить полученный эффект. Помимо этого весьма актуального вида окрашивания, сейчас существуют более сложные и не менее востребованные технологии окрашивания волос.

 

Сложные окрашивания волос: технология выполнения

Современные технологии окрашивания волос, такие как омбре, брондирование, шатуш, требующие при выполнении незаурядного мастерства, находятся на пике моды, в тренде. Рассмотрим технологии, которые пользуются наибольшим успехом среди модниц, и постараемся разобраться в том, чем вызваны такие тенденции моды.

1. Омбре Вот уже несколько сезонов подряд сложная технология окрашивания волос омбре продолжает оставаться очень востребованной. Она отлично подходит натуральным блондинкам и брюнеткам, рыжеволосым и девушкам с русыми волосами. Техника «омбре» заключается в создании четкой «границы» между различными оттенками или плавного перехода из одного тона в другой. Сначала волосы от середины до кончиков осветляют. Затем придают им основной цвет. Девушки, готовые к смелым экспериментам над собственной внешностью, при помощи техники «омбре» используют синие, красные и зеленые цвета. Весьма востребованный вариант – комбинация насыщенного черного цвета с белым.

2. Брондирование Брондирование относится к сложным технологиям окрашивания волос и предполагает плавный переход десятков оттенков темных и светлых тонов. При его использовании ожидается получение темного цвета с эффектом «выгоревших» на солнце прядей различных оттенков (красного, медного, янтарного, медового и т. д.). Окрашивание волос по технологии брондирования идеально подходит для шатенок и темно-русых девушек. При такой технике естественный цвет волос является основой для реализации замысла мастера. Статьи по теме Шоколадное обертывание в салоне красоты: польза, показания и противопоказания, себестоимость Безинъекционная карбокситерапия для лица в салоне красоты: особенности проведения процедуры Душ Шарко: описание услуги, показания и противопоказания, оборудование, окупаемость Визажист в салоне красоты: обязанности, услуги, специальность IPL-технология от А до Я Главное достоинство техники брондирования заключается в ее способности создавать визуальный эффект дополнительного объема. При грамотном выполнении этой технологии окрашивания волос тонкие волосы смотрятся более густыми, а отросшие корни на общем фоне не бросаются в глаза. Техника брондирования освежает кожу лица, выгодно ее оттеняя, позволяет «спрятать» первые седые волосы. Поэтому такую технологию окрашивания волос предпочитают женщины в возрасте. И все-таки, основной целью брондирования является сохранение естественной красоты ухоженных, блестящих волос.

3. Шатуш Сложная технология окрашивания волос «шатуш» позволяет получить плавный переход от более темных корней до осветленных кончиков. Техника создает впечатление большого объема, делает выбранные цвета глубокими и насыщенными. Благодаря созданию эффекта выгоревших волос прическа смотрится естественно и натурально. Сложное окрашивание волос в технике «шатуш» выполняется без использования фольги. Изменяют цвет небольших хаотично расположенных прядок, причем не по всей их длине, а с промежутками. Путем начесывания волос добиваются образования нечетких границ между оттенками. Согласно модным тенденциям технологию окрашивания волос при помощи техники «шатуш» выбирают не только натуральные брюнетки, но и блондинки. Однако на светлых волосах рекомендуется делать мелирование, потому что получаемый результат от техники «шатуш» недостаточно выразителен. Главным преимуществом техники «шатуш» является возможность получения эффекта выгоревших волос. С ее помощью можно устранить негативные последствия предыдущих окрасок. Основная цель технологии окрашивания волос в технике «щатуш» – визуально сделать фактуру волос более рельефной. Плавные переходы между оттенками позволяют намного реже подкрашивать отросшие корни.

4. Балаяж Сложная технология окрашивания волос «балаяж» позволяет успешно чередовать различные оттенки с четкими границами и переходами. Цветовая гамма подбирается индивидуально, в зависимости от цветотипа внешности, овала лица и длины волос. Среди обладательниц геометрически идеальных стрижек весьма актуально желание обработать кончики и середину волос, чтобы получить аккуратную «окантовку» без резких переходов и скачков цвета. У коротких волос в технике «балаяж» окрашиваются только кончики.

5. Тонирование Эта технология дает возможность органично сочетать широкий спектр различных оттенков. При тонировании волосы становятся более эластичными и послушными, что позволяет создавать весьма оригинальные прически. Технология окрашивания волос методом тонирования позволяет «избавиться» от седины и неестественной желтизны волос.

Перечисленные технологии окрашивания волос позволяют претворять в жизнь самые смелые и неординарные эксперименты со своей внешностью. Техники сложного окрашивания не наносят вреда волосам, сохраняют структуру, визуально увеличивает их густоту и объем.

 

Блочное, контурное и 3D-окрашивание волос: технология и особенности

Блочное окрашивание – новая оригинальная технология окрашивания волос.

Вначале мастером разрабатывается схема будущего сочетания цветов. Затем волосы делятся на несколько блоков. По желанию клиентки пряди окрашивают в контрастные или близкие по цветовой гамме оттенки. При использовании этой техники берутся стойкие краски, способные длительное время сохранять цвет. Технологию блочного окрашивания волос обычно выбирают девушки, не боящиеся оказаться в центре всеобщего внимания. Довольно часто такие цветосочетания используют на стрижках с выбритыми зонами или на «асимметрии».

Контурирование. Технология окрашивания волос в технике «контур» направлена на то, чтобы скрасить или выгодно выделить отдельные черты лица. Темные и светлые тона как будто играют между собой в прическах, выполненных в технике «контур». Контурирование – это новая техника окрашивания волос, позволяющая подчеркивать достоинства лица или скрывать его недостатки. Известно, что темные оттенки визуально «скрадывают», уменьшают, а светлые, наоборот, увеличивают и привлекают внимание. Сейчас эти свойства цветов широко используются при наложении макияжа (например, чтобы придать нужные пропорции и форму лицу, скулам и т. д.). Такие же приемы можно с успехом применять и при окраске волос. Для того чтобы правильно «рассчитать» темные и светлые участки на волосах, необходимо определить форму лица и поставить четкую задачу.  Овальная – самая сбалансированная форма, именно к ней направлена техника окрашивания волос «контурирование». Клиенту с овальным лицом вполне достаточно подобрать правильный оттенок волос. Чтобы придать выбранному цвету выразительность, можно выделить несколько прядей. Необходимости в дополнительных акцентах в данном случае нет. Чтобы придать круглому или квадратному лицу более «вытянутую в высоту» форму, нужно пряди, обрамляющие лицо, окрасить в темный тон до самых кончиков. Темный цвет визуально убирает часть ширины лица и «вытягивает» его вверх. Если у клиента вытянутое лицо и тяжелый подбородок, форму лица визуально уравновешивают, затемнив корни от пробора и до ушей, дальше переходят в светлые оттенки. Осветляют очень тонкие пряди у лица (примерно до скул). Все волосы внизу затылка затемняют, создают изнутри прически темный цвет. Треугольная форма лица (сердцевидная) – самая сложная для «корректировки». Одновременно потребуется визуально уменьшить верхнюю и слегка расширить нижнюю часть лица. Для этого корни окрашиваются в темный цвет, который на уровне ушей плавно переходит в светлый. Пробор лучше всего сделать по центру. Лицо должны обрамлять светлые по всей своей длине пряди волос. При выборе технологии окрашивания волос «контурирование» независимо от формы лица учитывается цвет кожи клиента. Неправильный оттенок может превратить лицо клиента в яркую маску или, наоборот, сделать его невыразительным. Поэтому необходимо сбалансировать выбранный цвет краски с оттенком кожи. Если кожа у клиента холодных оттенков, то для окрашивания волос подходят шоколадно-каштановый, цвет молочного шоколада или красного вина. С теплыми оттенками кожи отлично гармонируют темно-каштановый, медовый и медно-красные цвета.

3D-окрашивание является одной из самых популярных разновидностей колорирования. С помощью этой техники можно добиться значительного визуального увеличения объема прически. Технология 3D-окрашивание волос отлично подходит и брюнеткам, и светловолосым. Перед выполнением этой технологии на компьютере должно производиться моделирование будущей прически. Однако, к сожалению, большинство салонов не обзавелись необходимым оборудованием, поэтому полагаться приходится на искусство и вкус «исполнителя». В 3D-технологии окрашивания волос используют одновременно не более трех оттенков – один основной и два вспомогательных. Подбираются цвета, которые отлично гармонируют и между собой и с натуральным цветом волос. В этой технологии не допускается использование контрастных оттенков и резких цветовых перепадов. Окрашивание волос по 3D-технологии: На волосы затылочной части головы от уха и до уха наносят более темную краску (основную). Тем же тоном покрывают корни остальных волос. Волосы разделяют (от затылка ко лбу) на небольшие пряди шириной в 4-5 см. Пряди окрашивают по всей длине, чередуя оттенки дополнительных цветов. Чтобы сделать границу между прядями менее заметной, волосы снова разделяют на пряди и окрашивают повторно. Волосы, окрашенные по этой технологии, смотрятся великолепно, и полученный результат сохраняется довольно долго благодаря тому, что отрастающие кончики отлично «вписываются в картину».

 

Мужское окрашивание волос: технология мелирования

Среди представителей сильного пола самой актуальной технологией окрашивания волос признано мелирование. Если десять лет назад оно было темой довольно бурных и неоднозначных обсуждений, то сейчас считается одним из самых доступных и распространенных способов смены имиджа. Процедура мужского мелирования волос не затрагивает корни и кожу головы, поэтому абсолютно безопасна. Мужские волосы намного жестче женских (в организме мужчин больше тестостерона), поэтому их корни плохо поддаются окрашиванию. В связи с этим большинство мужчин решает осветлить только кончики волос. Чаще всего мужчины выбирают не контрастные оттенки, мало отличающиеся от их натурального цвета, чтобы только чуть-чуть освежить имидж. Профессиональный мастер из любых цветов сможет составить гармоничные сочетания. Технология окрашивания коротких волос направлена на создание эффекта красивого «солнечного» блеска или выгоревших прядей на волосах. Не менее популярно и мелирование в яркие, контрастные оттенки. Любой из этих вариантов имеет свои преимущества. Технология окрашивания волос мелированием в удачно подобранные цвета позволяет освежить или даже изменить имидж, не прибегая к полной окраске шевелюры.

Преимущества мужского мелирования:

·         не слишком резкая смена имиджа; выглядит стильно и модно;

·         абсолютно безвредно.

Недостатки мужского мелирования:

·         довольно большая стоимость и продолжительность процедуры;

·         мужские волосы с трудом поддаются окрашиванию;

·         достаточно проблематичное восстановление волос.

 

Существует два способа подобной технологии окрашивания волос у мужчин:

1. При помощи фольги. Его еще называют классическим. При окраске таким способом предварительно окрашенную прядь заворачивают в фольгу. Методика довольно простая и доступная для выполнения в салоне красоты или дома. Кусочком фольги отделяют прядь, наносят на нее обесцвечивающее средство. Фольгу аккуратно складывают пополам и заворачивают ее боковые срезы. Получившиеся «кармашки» фиксируют на голове зажимами или заколками. Способ отлично подходит для обесцвечивания.

2. При помощи специальной шапочки. Производится с помощью силиконовой шапочки с прорезями. Шапочку надевают на голову и через отверстия вытаскивают пряди, на которые наносят обесцвечивающее средство. Оставляют на 20-30 минут (время воздействия зависит от желаемой интенсивности цвета). Смывается красящий состав с использованием шампуня. Следовательно, мужское мелирование имеет целый ряд преимуществ. В тех случаях, когда мужчина пожелает освежить свой имидж, он может с успехом использовать эту несложную технологию окрашивания волос.

 

7 самых распространенных ошибок при окрашивании волос

Ошибка №1. Считать, что полученный оттенок полностью совпадет с указанным на упаковке. Ошибочно считать, что полученный оттенок будет абсолютно «цвет в цвет» с указанным на коробочке. Следует предупредить клиента, что результат во многом зависит от природного цвета и качества его волос. Необходимо использовать таблицу оттенков, приведенную на упаковке, чтобы представить, какой (примерно) цвет получится.

Ошибка №2. Начинать окраску волос без предварительной проверки на аллергическую реакцию. Некоторые недооценивают важность предупреждений производителей о необходимости проверки краски для выявления аллергии. Можно нанести капельку за ухо, на внутренний сгиб локтя или заднюю сторону шеи. Аллергическая реакция может проявляться в виде покраснения, кожного зуда или даже выпадения волос.

Ошибка №3. Не закрывать открытые участки кожи и одежду во время окрашивания волос. Перед началом окраски необходимо накрыть плечи клиента специальной защитной накидкой, чтобы предупредить появление пятен на коже и одежде. Кроме того, мастер должен надевать перчатки. Дополнительно защитить кожу от пятен можно, нанеся жирный питательный крем или вазелин на шею и уши. Если, несмотря на принятые меры предосторожности, какой-то участок все-таки был испачкан краской, просто протрите его ватным тампоном, смоченным в спиртовом лосьоне.

Ошибка №4. Перед окрашиванием пользоваться кондиционером. Перед окраской не следует использовать кондиционер для волос, вполне достаточно обычного мытья головы с шампунем. На волосах перед окрашиванием не должно быть жира и грязи. Ошибка №5. Нанесение краски на покрытые лаком волосы. Перед нанесением красящего состава волосы следует очистить. Секущиеся кончики волос рекомендуется состричь.

Ошибка №6. Увеличивать время воздействия, рекомендуемое инструкцией по использованию краски. Оставлять красящий состав на волосах дольше, чем рекомендует производитель, нельзя – это может нанести им непоправимый вред. Необходимо помнить, что повысить интенсивность цвета намного легче, чем высветлить. Когда полученный результат не удовлетворяет клиента, повторное окрашивание следует проводить не ранее, чем через 2-3 недели.

Ошибка №7. Окраска волос в цвета, отличающиеся от натурального оттенка более, чем на два тона. Полученный в результате окрашивания оттенок должен соответствовать цветотипу внешности (цвет кожи, глаз, и т. д.) Научные исследования доказали, что радикальное окрашивание волос может вызывать серьезные заболевания кожи. Особую опасность представляют «излюбленные» оттенки подростков (зеленый, фиолетовый, малиновый, и т. д.), потому что в их состав входит пара-фенилендиамин, вызывающий воспаления на коже.

 

Актуальные технологии окрашивания волос.

По заверениям стилистов, популярными будут как натуральные оттенки, так и броские, неординарные цвета.

1. Балаяж. Модным будет не простое затемнение или осветление, а применение ярких оттенков (например, вишневого, клубничного, золотистого и т. д.). Эта придаст свежесть и пышность окрашенным волосам.

2. Сомбре и омбре. Довольно часто их путают, потому что способы нанесения краски очень похожи. Главное различие состоит в том, что при омбре один цвет практически сразу с плохо размытой границей переходит в другой. При технике сомбре берут несколько оттенков и цвет как будто «перетекает». В наступающем модном сезоне будет доминировать каштановый оттенок. Мягкий переход цвета и созданные при окрашивании «солнечные» блики на волосах придадут неповторимость, женственность и романтичность. Градация цвета может проходить не только по вертикали, но и в горизонтальном направлении. Техника омбре чаще всего применяется на темных волосах (черных, темно-русых или насыщенно-каштановых), при окрашивании получается эффектная «копна» темных со светлыми кончиками волос. Обычно с середины прически начинается цветовой переход. Эта модная в будущем 2018 году технология окрашивания волос позволит мастерам создавать не только натуральные оттенки, но еще и непривычные, «ненатуральные», удивительные шедевры парикмахерского искусства. Самое главное – не ошибиться с выбором палитры цветов, и тогда волосы превратятся в красивые волны, искрящиеся «солнечными» бликами.  

3. Затемненные корешки Технология окрашивания волос с затемненными корешками – очень востребованный и популярный в 2018 году выбор блондинок сохранит свою актуальность и в 2019 году. Окрашивание создает эффект отросших корней, придает естественность и оригинальность прическе. Удивительно, но факт, что всего лишь пару лет назад «выставлять напоказ» отросшие корни считалось дурным тоном, теперь же мастера превозносят этот стиль чуть ли не до небес. Немаловажно, что такая техника окрашивания отлично подходит для волос любой длины.

4. Splashlight  Довольно сложная, но вместе с тем очень интересная технология окрашивания волос. В переводе означает «всплеск цвета». Позволяет мастеру создать эффект сияющего (причем, в любое время суток и при любой погоде) солнечного лучика, «заблудившегося» в волосах.

5. Пиксельная техника. Эта технология окрашивания волос придумана испанскими мастерами. Может подойти далеко не каждой моднице. В результате окрашивания вместо плавных переходов цвета получаются своеобразные «пиксели», хаотично «разбросанные» по волосам. Окрашенные в такой технике волосы необходимо ежедневно тщательно укладывать необычным способом. Пряди волос требуется постоянно распрямлять и фиксировать в определенном порядке.

6. Голографическое колорирование. Такая техника позволяет мастеру создать сразу несколько переходов цвета (например, осветлить пару прядей, придать им пастельные оттенки).

 

 

7. Дим-аут Техника частичного затемнения позволяет создать 3D-эффект и визуально увеличить объем волос. Выполняется путем прокрашивания прядей на определенных участках (например, в 1-2 местах). Эта технология окрашивания волос имеет существенный недостаток – требует ежедневного кропотливого ухода.

8. Мелирование При выполнении мелирования не следует выделять светлые пряди на темном фоне остальных волос. Они должны «прятаться» среди тех, что близки по оттенку. Эта технология окрашивания волос позволяет мастеру украсить клиента отдельными красивыми прядками цвета пшеницы или зрелого меда.

9. Babylights. Эта технология окрашивания волос также известна под названием «солнечные зайчики». Отлично подходит для девушек, не желающих перекрашивать все волосы (даже наполовину). Техника позволяет мастеру создать эффект слегка выгоревших на солнце локонов. Выполняется путем осветления только кончиков волос на нескольких прядках. Такая технология окрашивания идеально смотрится на волосах светло-каштанового и русого цвета.

 

Источник: https://www.dirsalona.ru/article/1057-tehnologii-okrashivaniya-volos

 

Окрашивание бровей в Казани. 17 лучших мастеров и салонов красоты.

Полезная информация о Окрашивании бровей

ОКРАШИВАНИЕ БРОВЕЙ - ЭТО ИСКУССТВО

На самом деле окрашивание бровей - это целое искусство. Только профессиональный специалист, учитывая все нюансы – форму лица, тип кожи, соответствие последним тенденциям, может грамотно подобрать правильную форму – длину и ширину брови, а также нужный оттенок краски.

Форма прорисовки брови в зависимости от типа лица

Неправильная геометрия может испортить внешность. Поэтому прежде чем приступить к окрашиванию бровей, нужно изучить несколько нюансов:

  • для круглого лица идеально подойдет изломанная бровь с высоким основанием и коротким кончиком;
  • для овального лица идеальная форма чуть закругленная, в которой основание немного отдалено от переносицы;
  • для треугольного лица подойдут слегка приподнятые брови с равномерным изгибом;
  • квадратному лицу показаны широкие, высокие и дугообразные брови;

Окрашивать рекомендуется не только сами волоски, но и участки кожи, чтобы создать эффект растушевки. Особенно это актуально для людей, у которых на бровях имеются шрамы или проплешины. Поэтому начинается окрашивание с прорисовки самого «скелета» брови. Вот как поступает грамотный мастер:

  • с помощью карандаша соединяет точку у крыла носа и точку внутреннего угла глаза. В том месте, где карандаш пересекается с бровью, бровь должна начинаться;
  • с помощью карандаша выстраивает вертикальную линию, проходящую через внешнюю границу радужной оболочки. В этом месте должна находится самая высокая точка брови;
  • а вот заканчиваться бровь должна в точке пересечения брови с карандашом, направленным от крыльев носа через внешний угол глаза;

 

Сегодня окрашивание бровей подразделяется на временное и стойкое:

  • Временное окрашивание – это как прорисовка формы брови специальным карандашом, тенями, тушью, помадой и так далее, так и окрашивание краской или хной. В последнее время особую популярность получило именно «хнойное» окрашивание, так как оно считается более естественным и стойким. Пигмент сохраняется неделю, а при должном уходе и не использовании щелочных средств может держатся до двух недель;
  • Стойкое окрашивание – это окрашивание на более длительный период. Здесь также различают несколько видов:
    • Классический татуаж бровей или перманентный макияж – это введение пигмента под кожу. Таким образом, мастер вводит краску на глубину около мм в верхний слой эпидермиса. Часто используется при коррекции шрамов и ожогов. Результат держится 5 лет, а то и больше;
    • Микроблейдинг бровей – это разновидность подкожного окрашивания бровей, только пигмент вводится мастером не с помощью машинки для татуажа, а вручную. Таким образом, профессиональная коррекция бровей состоит в прорисовке мастером каждого отдельного волоска якобы натуральной брови. Это очень деликатная техника. Она требует определенного навыка и предельной концентрации мастера, ведь права на ошибку у него нет. Техника очень естественная. Пигмент сохраняется на протяжении 3-5 лет;
    • Растушевка бровей – это биотатуаж, при котором используется не волосковая, а теневая техника. Пигмент растушевывается, таким способом удается добиться полутонов.
Стойкое окрашивание бровей: плюсы и минусы
  • Главное преимущество техник татуажа – это долговременность. О профессиональной коррекции бровей после основной процедуры можно забыть надолго. Брови не придется постоянно подкрашивать, они всегда будут идеальной формы независимо от ситуации;
  • Главный недостаток долговременного окрашивания – это вмешательство в верхние слои эпидермиса и травмирование кожи, ведь татуаж – это по сути микро-надрезы. Более того, используя такую технику, мастер не имеет права на ошибку, а дать 100% результат, что эффект вам понравится, не может никто.

 

Записаться на процедуру окрашивание бровей можно к любому специалисту онлайн. Помните, что процедура временного пигментирования занимает 10-15 минут, а стойкое окрашивание длится 1,5-2 часа в зависимости от выбранной техники.

Crossfashion Group - Почему смывается цвет окрашенных волос? Причины и способы решения проблемы

Парикмахеры нередко шутят: клиентки считают, вот если бы у них после окрашивания волосы сразу нужного цвета отрастали - это была бы по-настоящему стойкая краска, а все, что предлагает современная косметическая промышленность — так, баловство! Шутки шутками, однако нередко цвет окрашенных волос и правда смывается очень быстро, почему это происходит и как избежать вымывания пигмента?
Попробуем разобраться...

Обычно производители красителей для волос дают гарантию стойкости цвета от 20 дней до полутора месяцев. Это зависит от очень многих составляющих: плотности пигмента и цвета красителя (так, например, темные натуральные и шоколадные оттенки держатся на волосах гораздо дольше, чем красные, рыжие и, тем более, светлые), состояния волос, процента окислителя и т. д. Цвет может вымываться из-за нарушения технологии окрашивания и по ряду других причин. Рассмотрим самые типичные из них.

 

Цвет быстро смывается потому что... он нетипичен для данного фона осветления.

Здесь мы рассмотрим ситуации, когда очень быстро смывается не сам цвет, а его оттенок. Этот вопрос актуален особенно сейчас, когда в моде всевозможные «шоколадно-золотистые» и «карамельные» тона.

 

Не вдаваясь в тонкости строения волос примем как данность, что натуральные волосы содержат пигменты (седина — волосы лишенные пигмента). Чем темнее волосы, тем больше пигментов они содержат. Черный цвет складывается из синих, красных, оранжевых и желтых пигментов, темно- русые (или 5.0 профессиональным языком) содержат красные, оранжевые и желтые пигменты, русые (7.0) - оранжевые и желтые, и светлые (9.0 и выше) - желтые.

 

Если воздействовать на волосы обесцвечивающими препаратами, пигменты растворяются в следующей последовательности: с 1 по 5 уровень уходит синий пигмент, с 5 по 6 - красный, с 6 по 7 - оранжевый и с 8 по 10 и выше - желтый.

 

Фоны осветления волос и пигменты, преобладающие в них.

 

1 уровень — черный (синие пигменты)
2 уровень — коричневый
3 уровень - коричнево- красный
4 уровень - красно- коричневый
5 уровень - красный
6 уровень - красно- оранжевый
7 уровень - оранжевый
8 уровень - желтый
9 уровень — светло-желтый
10 уровень — золотистый

 

Наибольшее количество синего пигмента в черных волосах, именно поэтому в палитрах профессиональных и бытовых красок существует иссиня-черный цвет и не существует, например, красно-черного: красный пигмент проявляется на волосах только с 5-го уровня, а значит, на черных волосах попросту не буден виден.

То же самое касается красного цвета на 6 и 7 уровнях: оптимальный фон для красных оттенков волос — 5-й, максимум 6-й, на 7-ом уровне красные тона будут очень быстро вымываться в оранжевые, характерные для 7-го фона.

По аналогии, на 9-ом фоне крайне сложно получить рыжие (именно рыжие, а не желтые) оттенки, характерные для 7-го фона.

Что это значит? Например, исходный цвет волос 6.0, желаемый цвет 9.44 в палитре красок Indola ( 9 — уровень осветления, 44 — медно-медный).

Получить его можно, если смешать краситель с 9% окислителем, который даст шаг в 2,5-3 тона и вытянет фон осветления волос с 6-го уровня до 9-го. Для 9-го уровня осветления волос характерны желтые пигменты, оранжевые пигменты (.44) волос получит из краски. Такой цвет не будет стойким и может быстро смыться в желтый.


Как получить более стойкий рыжий цвет с 6-го натурального уровня? Вывести цвет на естественный для рыжих оттенков фон — 7-й, где как раз преобладают оранжевые пигменты и взять краску не 9.44, а 7.44 с 3% или 6% окислителем, в зависимости от состояния волос (седина и пр.).

 

То же самое касается шоколадно-золотистых оттенков на 6 и 7 фоне осветления, например, 6.73 и 7.73 в палитре Wella, где цифра до точки - уровень осветления, первая цифра после точки 7 — коричневый, вторая цифра после точки 3 — золотистый.

Как правило, такие оттенки получаются на волосах не золотистыми, а рыжеватыми(что физиологично для 6 и 7 фона осветления, где преобладают как раз оранжевые пигменты), а если и получаются, то очень быстро вымываются в рыжий. Избежать этого можно, если регулярно (примерно раз в две недели) освежать цвет в парикмахерской или дома, например, полуперманентными красителями, что удовольствие недешевое. Т.е. подобные неестественные для фона осветления цвета можно получить, но держаться на волосах месяц и более они не будут!


«А как же всякие Оливии Палермо, Дженнифер Лопес и прочие звезды мирового уровня? У них-то с цветом волос все ок!».

Оливия Палермо

Да, ок, но они салоне бывают не реже раза в две недели, если вы готовы с такой регулярностью освежать цвет своих волос — за вас можно только порадоваться. Ну а простые смертные, владея подобной информацией, просто смогут выбрать для себя более носибельный оттенок.

 

Цвет смывается, потому что... волосы слишком пористые.

Пористые волосы не способны удерживать искусственные пигменты. Как волос становится пористым? К сожалению, сплошь и рядом это происходит не без участия парикмахеров, которые производят повторное окрашивание волос на высоких процентах окислителя. Проанализируем уже рассмотренный выше пример с окрашиванием из 6.0 в 9.44 с позиции окислителя: первый раз мы взяли 9% окислитель (при условии, что речь идет об окрашивании натуральных волос уровня 6.0). При вторичном окрашивании (когда краситель сначала наносится на корни волос, а через 15-20 минут, в зависимости от красителя, по полотну волос) отросшие корни необходимо красить также с применением 9% окислителя, а вот по длине 9% окислитель совершенно не нужен! Цвет волос по полотну необходимо только обновить, растворять натуральный пигмент в них уже не надо, так для чего брать 9%, если можно щадящим способом покрасить длину с применением 3% или даже 1,9%-1,5%?

Безусловно, проще один раз приготовить смесь и покрасить ею всю голову, более того, некоторые мастера считают, что за 15-20 минут окислитель «выдыхается» и не вредит волосам, но это не так! Ничто и никуда не выдыхается, идет химическая реакция! Если по инструкции краситель должен быть нанесен на волосы сразу после разведения окислителем (и это один результат), то распределив по волосам, краситель в середине химической реакции результат получается другой — пористые волосы (повторюсь, никуда и ничего не выдыхается, был 9% при разведении и остался 9% через 20 минут после разведения, только в другой стадии химической реакции) и нестойкий цвет, т. к. краска была распределена по волосам в середине химической реакции!

 

Что делать в этом случае? Красить корни с применением 9%, а длину, используя низкие проценты окислителя; разводить краску два раза (для корней и для полотна волос) и наносить ее сразу после смешивания с окислителем, а не через 20 минут!

 

Стабилизировать пигменты в краске можно с помощью усилителей цвета или микс-тонов. Этот способ подходит в том случае, если волосы окрашиваются в ярко-красные и ярко-рыжие оттенки. В смесь с красителем красного цвета необходимо добавить фиолетовый микс-тон (фиолетовый содержит синие пигменты, которые будут удерживать красный пигмент), а в смесь с красителем медного оттенка добавить красный микс-тон. В этих случаях цвет может получиться с небольшим отливом фиолетового и красного, но оттенок довольно быстро смоется, зато цвет будет дольше насыщенным, ярким и стойким. Сколько микс-тона нужно добавлять зависит от марки красителя (плотности пигмента) и вопрос этот очень индивидуальный, однако, чтобы сориентировать читателей, могу сказать, что в такие красители, как Wella (Сoleston) и Schwarzkopf (Igora), можно не опасаясь добавлять 1 см микс-тона. Такое количество практически не отразится на цвете, но замедлит процесс вымывания пигмента из волос.
Палитра микс-тонов российской краски Estel Luxury

О желтизне на обесцвеченных и светленных волосах подробно рассказывалось в статье:
«Желтизна волос у блондинок. Почему волосы желтеют, и как с этим бороться?»

 

Один из самых популярных советов после окрашивания волос в парикмахерской: купите у нас красящий шампунь для поддержания того или иного цвета (благо сейчас таких шампуней хоть по палитре выбирай), и будет вам счастье!


Тонирующие шампуни действительно могут поддержать цвет обесцвеченных и осветленных волос, а также окрашенных в ярко-красные или шоколадные оттенки, но если волосы регулярно подвергаются агрессивному воздействию окислителей высоких процентов, никакие шампуни ситуацию не спасут.

 

Если у вас есть вопросы, вы можете задать их в комментариях. Мы постараемся как можно быстрее ответить вам.

 

Еще по теме:

 

В чем разница между профессиональной краской и обычной?

 

Как смыть черный цвет окрашенных волос? Советы и рецепты смывок

 

Фото: Фото: evapro.ru, beautydis.com, theplace.ru, lavsonia.ru, szepsegcikk.hu, parfumka-shop.com.ua, lessera.ru

 

Вернуться на главную

 

 

3д окрашивание волос пошагово на темные и светлые волосы » WomanMirror

Еще не так давно натуральные и красивые оттенки волос считались для девушек утопией. Любая барышня, у которой возникало желание поменять цвет своей шевелюры, знала, что достичь естественности образа с покрашенными прядями будет довольно сложно. К счастью, стремительно развивающиеся современные технологии затронули и процессы окрашивания волос.

Мало кому известно, почему естественный оттенок локонов выглядит более объемным и глубоким по сравнению даже с самой профессиональной краской. На самом деле причиной этому является неравномерность цветовых оттенков. Отличительная особенность естественной шевелюры заключается в содержащейся в ней гамме цветов, поражающих своей неоднородностью. Так при свете дня и в темное время суток локоны выглядят абсолютно по-разному. На протяжении длительного периода времени такого эффекта не могли добиться ни при помощи колорирования, ни мелирования. Однако с тех пор как появилось объемное 3д окрашивание волос, достичь такой результат стало вполне реально.

Особенности метода окрашивания волос с эффектом 3д

Главной особенностью технологии является не только использование смежных оттенков, но и сама система нанесения краски.

  • В первую очередь необходимо отметить, что объемное 3d окрашивание волос подразумевает наличие основного оттенка и одного или двух дополнительных тонов. Обратите внимание, что все тона должны находиться в рамках одного цвета, что позволяет сделать плавный и более естественный переход. Более того, сочетание оттенков одного цвета создает эффект как глубины и полноты, так и объема.
  • Окрашивание волос 3д требует и определенной методики нанесения краски. Это объясняется тем, что при покраске локонов особое внимание нужно уделять прикорневой и затылочной части. Для того чтобы поддержать естественный переход, некоторые пряди необходимо окрасить при помощи дополнительного цвета.

Техника 3д окрашивания волос

Инструкция покраски шевелюры включает в себя несколько этапов:

  1. На первом этапе необходимо окрасить затылочную часть базисным оттенком.
  2. Затем, используя более светлый оттенок, красят несколько прядей около затылка, толщина которых составляет около 1,5 см.
  3. После этого, необходимо опуститься к низу затылка, прокрашивая пряди с помощью чередования светлого и темного оттенков.
  4. То же самое проделывают, переходя к височной части. Обратите внимание, что первую прядь нужно обязательно окрасить базисным цветом.
  5. Эта же схема наблюдается при работе с теменной областью, красить которую необходимо в последнюю очередь.

Конечно, абсолютно точной методики объемного 3д окрашивания не существует, поскольку все будет зависеть от длины шевелюры и количества используемых оттенков. Однако если поэтапно изучить вышеперечисленные принципы, они смогут помочь разобраться в основе технологии покраски шевелюры нового поколения. Главное пошагово следовать предложенной схеме.

3д окрашивание на светлые волосы

3 д окрашивание волос будет великолепно смотреться на блондинках. В этом можно убедиться, посмотрев на фото, на котором изображены волосы до и после объемного окрашивания. Этот довольно сложный цвет прядей должен быть естественным и гармоничным на столько, насколько это возможно, а ни в коем случае не напоминать куклу. Именно поэтому 3д окрашивание на светлые волосы будет как раз кстати.

Более того, окрашивание волос 3д позволит плавно переходить из одного цвета в другой. Так, к примеру, абсолютно реально перекраситься из черного цвета в светлый. Правда для этого нужно большое количество терпения, чтобы добиться качественного результата и сохранить здоровье своей шевелюры.

3д окрашивание на темные волосы

Первоначально 3d окрашивание волос было опробовано на светлых локонах, поскольку на блондинках такой эффект выглядит наиболее натурально. Однако со временем популярностью стало пользоваться и 3д окрашивание на темные волосы. Причина солнечных бликов на обладательницах темной шевелюры кроется в специальной технике покраски. Так, при передержке осветляющего красителя пряди могут получиться совсем неестественными, что абсолютно не украсит девушку. При этом обязательно провести процедуру тонирования, которая сгладит контраст между натуральными и обесцвеченными волосами.

Преимущества и недостатки 3D окрашивания шевелюры

Прежде чем решиться на современную процедуру необходимо изучить все положительные и отрицательные стороны этой покраски прядей. 3д окрашивание волос обладает рядом достоинств, таких как:

  • Оно создает иллюзию мелирования. Однако цвет при этом выглядит более естественно и, что немало важно благородно.
  • 3д волосы зрительно увеличиваются в объеме.
  • Данное мероприятие позволяет сделать любую прическу более привлекательной и ухоженной.
  • После 3д окрашивания цвет локонов более динамичный и интересно играющий на свету.
  • На “гриве” появляются блики, привлекающие внимание окружающих, что делает образ еще более женственным.
  • Техника 3д окрашивания волос выделяет определенные пряди или отдельные части прически.
  • Не зависимо от “роста шевелюры” цвет все равно остаётся довольно насыщенным, таким образом, корректировать его можно примерно раз в месяц.

Недостатки 3д окрашивания:

  • Техника является довольно сложной, поэтому проводить объемное 3d окрашивание самостоятельно в домашних условиях практически невозможно.
  • 3d волосы требуют дополнительного ухода. Неухоженные локоны будут казаться не переливающимися, а тусклыми и грязными.
  • Освежать цвет шевелюры нужно при помощи только опытного специалиста.
  • Если неправильно подобрать оттенки цвета, то результат, безусловно, не оправдает своих ожиданий.

Необходимо отметить, что эта техника покраски шевелюры считается совсем новой. В связи с этим существует не такое большое количество специалистов, которые выполнят работу на действительно высоком уровне. Немногие из них способны адекватно оценить пожелания клиента и выбрать нужные оттенки. Поэтому, если девушка решила сделать самой себе такой подарок, в первую очередь нужно уделить особое внимание поиску опытного мастера, иначе результат может получиться абсолютно непредсказуемым.

Видео: Техника объёмного 3D окрашивания волос

Ингибирование и роль let-7d в идиопатическом фиброзе легких

Кусум В. Пандит

1 Отделение легочной медицины, аллергии и реанимации, Центр интерстициальной болезни легких Дороти П. и Ричарда П. Симмонс, Университет Питтсбургская школа медицины и 2 Департамент генетики человека Высшей школы общественного здравоохранения Питтсбургского университета, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Дэвид Коркоран

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Ханади Юсеф

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент компьютерной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Манохар Ярлагадда

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Argyris Tzouvelekis

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии Медицинской школы Университета Питтсбурга, Питтсбург, Пенсильвания

Кевин Ф.Gibson

1 Отделение медицины легких, аллергии и интенсивной терапии, Центр интерстициальных заболеваний легких Дороти П. и Ричарда П. Симмонса, Медицинская школа Университета Питтсбурга, и 2 Отделение генетики человека, Высшая школа Общественное здравоохранение, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент компьютерной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Кадзухиса Кониши

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии Медицинской школы Университета Питтсбурга, Питтсбург, Пенсильвания

Сэмюэл А.Yousem

1 Отделение легочной медицины, аллергии и интенсивной терапии, Центр интерстициальных заболеваний легких Дороти П. и Ричарда П. Симмонса, Медицинская школа Университета Питтсбурга, и 2 Отделение генетики человека, Высшая школа Общественное здравоохранение, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Мандал Сингх

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Дэниел Хэндли

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент компьютерной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Томас Ричардс

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент компьютерной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Мойзес Селман

1 Отделение легочной медицины, аллергии и интенсивной терапии, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии Медицинской школы Университета Питтсбурга, Питтсбург, Пенсильвания

Саймон К.Watkins

1 Отделение легочной медицины, аллергии и реанимации, Центр интерстициальных заболеваний легких Дороти П. и Ричарда П. Симмонса, Медицинская школа Университета Питтсбурга, и 2 Отделение генетики человека, Аспирантура Общественное здравоохранение, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Энни Пардо

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Ахми Бен-Иегуда

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Демосфен Бурос

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент компьютерной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Оливер Эйкельберг

1 Отделение легочной медицины, аллергии и интенсивной терапии, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии Медицинской школы Университета Питтсбурга, Питтсбург, Пенсильвания

Прабир Рэй

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии Медицинской школы Университета Питтсбурга, Питтсбург, Пенсильвания

Панайотис В.Benos

1 Отделение медицины легких, аллергии и интенсивной терапии, Центр интерстициальных заболеваний легких Дороти П. и Ричарда П. Симмонса, Медицинская школа Университета Питтсбурга, и 2 Отделение генетики человека, Высшая школа Общественное здравоохранение, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент компьютерной биологии, Школа медицины Университета Питтсбурга, Питтсбург, Пенсильвания

Нафтали Камински

1 Отделение легочной медицины, аллергии и реанимации, Дороти П.и Центр Ричарда П. Симмонса интерстициальной болезни легких, Медицинская школа Университета Питтсбурга, и 2 Департамент генетики человека, Высшая школа общественного здравоохранения, Университет Питтсбурга, Питтсбург, Пенсильвания; 3 Отделение пневмонологии Медицинской школы Университета Демокрита во Фракии и Университетской больницы Александруполиса, Александруполис, Греция; 4 Отделение патологии, Университет Питтсбурга, Питтсбург, Пенсильвания; 5 Instituto Nacional de Enfermedades Respiratorias, Мехико, Мексика; 6 Отделение клеточной биологии и физиологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания; 7 Facultad de Ciencias, Национальный автономный университет Мексики, Мехико, Мексика; 8 Центр комплексной пневмологии, Мюнхен, Германия; и 9 Департамент вычислительной биологии, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания

Frontiers | Фенотип-независимая изоляция межвидовых гибридов Saccharomyces с помощью флуоресцентного окрашивания двумя красителями и сортировки клеток с активацией флуоресценции

Введение

Дрожжи Saccharomyces используются в различных биотехнологических отраслях, включая пивоварение, виноделие, биофармацевтический синтез белка и производство биотоплива (Balat, 2011; Nielsen, 2013; Marsit and Dequin, 2015; Jansen et al., 2017; Krogerus et al., 2017a). В настоящее время описано девять видов Saccharomyces (Hittinger, 2013; Nueno-Palop et al., 2017), которые разделены постзиготическим барьером, который делает межвидовые гибриды стерильными (Naumov et al., 2000; Greig et al., al., 2002; Pfliegler et al., 2012; Hou et al., 2014). Хотя гибридов Saccharomyces встречаются в естественных условиях, таких как кишки ос (Stefanini et al., 2016), штаммы с химерными геномами чаще всего встречаются в домашних условиях (Almeida et al., 2014; Бойнтон и Грейг, 2014). Например, светлое пиво варят гибридов S. cerevisiae × S. eubayanus , все вместе обозначаемых как S. pastorianus (Libkind et al., 2011), S. uvarum × гибриды S. eubayanus под названием S. bayanus используются, среди прочего, для пивоварения сидра (Наумов и др., 2001), а также различные двойные и тройные гибриды между S. cerevisiae , S. kudriavzevii и S.uvarum играют важную роль в производстве аромата во время ферментации вина (González et al., 2006). Кроме того, межвидовая гибридизация, вероятно, способствовала эволюции одомашненных штаммов Saccharomyces , облегчая горизонтальный перенос генов (Peter et al., 2018). Генетическая примесь внесла свой вклад в различные фенотипы, например, ферментирующих сидр штаммов S. uvarum и ферментирующих вино штаммов S. cerevisiae (Наумова и др., 2011; Dunn et al., 2012).

Было показано, что геномы гибридов от разных видов Saccharomyces действуют синергетически, явление, называемое «гетерозис» или «сила гибрида», при котором гибрид проявляет себя лучше, чем любой из его родителей в определенных условиях (Rainieri et al., 2006; Belloch et al., 2008; Querol, Bond, 2009; Tronchoni et al., 2009). Гетерозис - сложное явление, включающее эффекты числа копий, взаимодействия между различными доминантными и рецессивными аллелями и эпистатические взаимодействия (Shapira et al., 2014). Физиология гибридов во многом зависит от конкретных родительских штаммов (Mertens et al., 2015; Krogerus et al., 2017b). Хотя некоторые признаки, такие как криотолерантность или флокуляция, по-видимому, полностью унаследованы от одного из родительских штаммов (Coloretti et al., 2006; Hebly et al., 2015), гибриды также могут проявлять фенотипы, промежуточные по отношению к их родительским штаммам, как было продемонстрировано. для производства ароматических соединений и других метаболитов (Bellon et al., 2011; Krogerus et al., 2015).

Saccharomyces гибридов были получены в лаборатории путем скрещивания штаммов разных видов (Banno and Kaneko, 1989).По аналогии с химерными гибридами, используемыми для промышленного применения, лабораторная гибридизация может дать штаммы с новыми или улучшенными свойствами для промышленного применения. Например, полученные в лаборатории гибриды S. cerevisiae × S. eubayanus показали повышенную устойчивость к холоду, более быстрое потребление олигосахаридов, разные вкусовые характеристики, более высокие скорости ферментации и более высокие титры этанола, чем их родительские штаммы (Steensels et al., 2014a; Hebly et al., 2015; Krogerus et al., 2015). Новаторские исследования по реконструкции встречающихся в природе гибридов вдохновили создание гибридов из новых комбинаций видов, таких как гибридов S. cerevisiae × S. paradoxus, (Bellon et al., 2011), S. cerevisiae × S. mikatae гибридов (Bellon et al., 2013; Никулин и др., 2017), гибридов S. cerevisiae × S. arboricola (Никулин и др., 2017) и гибридов S. cerevisiae × S. uvarum (Masneuf -Pomarède et al., 2002; Bellon et al., 2015; Lopandic et al., 2016). Их фенотипическое разнообразие показало многообещающее применение в самых разных сферах - от производства ферментированных напитков до производства биотоплива (Masneuf-Pomarède et al., 2002; Steensels et al., 2014b; Nikulin et al., 2017; Peris et al., 2017; Nikulin и др., 2018).

Аналогично внутривидовому спариванию, межвидовая гибридизация происходит либо путем спаривания гаплоидных клеток противоположного типа спаривания, либо путем редкого спаривания на основе спонтанного переключения типа спаривания, вызванного потерей гетерозиготности в локусе MAT (Gunge and Nakatomi, 1972). .Однако межвидовая гибридизация происходит с относительно низкой скоростью; зарегистрированные частоты гибридизации варьируются от 1,5 до 3,6% для массового спаривания спор (Mertens et al., 2015; Krogerus et al., 2016) до частот от 1 × 10 −6 до 1 × 10 −8 для массовое спаривание клеток зависит от редкого спаривания (Gunge, Nakatomi, 1972; Krogerus et al., 2016). В то время как эффективность межвидового спаривания может быть улучшена методами генетической модификации (ГМ), например, сверхэкспрессией НО-эндонуклеазы (Alexander et al., 2016) или с помощью микроманипуляции со спорами (Наумов, 1996), изоляция bona fide гибридов от брачных культур остается необходимой.

Если родительские штаммы имеют разные выбираемые фенотипы, гибриды могут быть выделены путем переноса культуры спаривания в условия, требующие для роста обоих фенотипов. Избираемые фенотипы, такие как ауксотрофии, могут встречаться либо в природе (Sato et al., 2002; Fernández-González et al., 2015; Magalhães et al., 2017), либо они могут быть получены с помощью мутагенеза и / или лабораторной эволюции в условиях, благоприятствующих ауксотрофности. штаммы (Boeke et al., 1987; Scannell et al., 2011; Перес-Травес и др., 2012; Krogerus et al., 2015). Однако создание ауксотрофных мутантов требует времени и труда (Alexander et al., 2016) и может быть дополнительно осложнено полиплоидной или анеуплоидной природой многих промышленно значимых штаммов Saccharomyces (Pérez-Través et al., 2012 ; Гортер де Фрис и др., 2017b). Альтернативно, селектируемые фенотипы, такие как устойчивость к антибиотикам, могут быть введены с использованием методов GM (Jimenez and Davies, 1980; Goldstein and McCusker, 1999; Piotrowski et al., 2012; да Силва и др., 2015; Hebly et al., 2015). Тем не менее, промышленные штаммы могут быть устойчивыми к ГМ, а вопросы принятия потребителями и законодательства по-прежнему в значительной степени препятствуют использованию ГМ-технологии для приложений в пищевой промышленности и индустрии напитков (Wunderlich and Gatto, 2015; Gorter de Vries et al., 2017a).

Сортировка клеток, активируемая флуоресценцией (FACS), может использоваться для выделения флуоресцентных клеток из популяций, даже если они происходят с чрезвычайно низкими частотами (Cormack et al., 1996). Путем маркировки каждого родительского штамма флуоресцентным красителем ранее использовалась FACS для сортировки спаренных клеток Saccharomyces cerevisiae из их культуры спаривания, что приводило к троекратному обогащению спарившихся клеток (Bell et al., 1998). Хотя трехкратного обогащения было бы недостаточно для выделения межвидовых гибридов из культуры спаривания, это раннее исследование подняло вопрос, возможно ли достаточно изменить процедуры окрашивания, спаривания и FACS для достижения этой цели. Чтобы ответить на этот вопрос, мы исследовали метод выделения межвидовых гибридов Saccharomyces на основе двойного флуоресцентного мечения родительских штаммов и последующего отбора дважды окрашенных клеток на основе FACS без какой-либо зависимости от каких-либо выбираемых фенотипов.После воспроизведения выделения внутривидовых скрещиваний S. cerevisiae , мы оптимизировали изоляцию межвидовых гибридов S. cerevisiae × S. eubayanus , используя штаммы с выбираемыми фенотипами. Затем полученный метод был протестирован на фенотип-независимое выделение гибридов S. cerevisiae × S. eubayanus .

Материалы и методы

Штаммы, среды и культивирование

Saccharomyces cerevisiae и S.eubayanus , использованные в этом исследовании, перечислены в таблице 1. Штаммы обычно выращивали на комплексной среде (YP), содержащей 10 г L -1 дрожжевого экстракта и 20 г L -1 пептона с добавлением 20 г L -1 глюкозы для YPD и с 20 г л -1 трегалозы для YPT. Синтетическая среда (SM), содержащая 20 г л -1 глюкозы, 3 г л -1 KH 2 PO 4 , 5,0 г л -1 (NH 4 ) 2 SO 4 , 0.5 г L -1 MgSO 4 ⋅7H 2 O, 1 мл L -1 раствора микроэлементов и 1 мл L -1 раствора витаминов, были приготовлены, как описано ранее (Verduyn et al., 1992), а pH был установлен на 6,0 с использованием 2 М КОН. Наличие кассеты с маркером KanMX было выбрано для SM + G418: SM с добавлением 0,2 г L -1 G418 (Invitrogen, Carlsbad, CA, United States), в котором (NH 4 ) 2 SO 4 был заменен 1 г L -1 глутамата натрия мононатрия (Cheng et al., 2000). Для твердых сред к среде добавляли 20 г л агара -1 . Штаммы выращивали в круглодонных встряхиваемых колбах объемом 500 мл со 100 мл среды при 200 об / мин в шейкере-инкубаторе Innova 44 (Eppendorf, Nijmegen, Нидерланды). Культуры S. cerevisiae и S. eubayanus выращивали при 30 ° C и 20 ° C соответственно. Жидкая среда для споруляции содержала 20 г L -1 ацетата калия, а ее pH был установлен на 7,0 с использованием уксусной кислоты (Bahalul et al., 2010). Замороженные исходные смеси готовили путем добавления глицерина (30% об. / Об.) К экспоненциально растущим культурам во встряхиваемых колбах, после чего аликвоты объемом 1 мл хранили в асептических условиях при -80 ° C.

Таблица 1. Saccharomyces штаммов, использованных в этом исследовании.

Споруляция, изоляция спор и прорастание

Споруляцию проводили путем аэробной инкубации при 20 ° C в течение не менее 72 часов на среде для споруляции. Наличие асков подтверждали с помощью фазово-контрастной микроскопии при увеличении 400x. Споры выделяли, как описано Herman and Rine (1997) с небольшими модификациями. Вкратце, споры осаждали (1000 г, , 5 мин), ресуспендировали в смягчающем буфере (10 мМ дитиотреитол, 100 мМ Tris-SO 4 , pH устанавливали на 9.4 с H 2 SO 4 ) и инкубировали при 30 ° C в течение 10 мин. Затем клетки промывали деминерализованной водой, ресуспендировали в буфере для сферопластинга [2,1 M сорбит, 10 мМ KH 2 PO 4 , pH устанавливали на 7,2 с помощью 1 M NaOH, 0,8 г L -1 зимолиаза 20-T (AMS Biotechnology, Ltd., Abingdon, United Kingdom)] и инкубировали в течение ночи при 30 ° C. После инкубации культуру осаждали (1000, г, , 10 мин), промывали деминерализованной водой и ресуспендировали в 0.5% Triton X-100 (Sigma-Aldrich, Zwijndrecht, Нидерланды). Затем споры обрабатывали ультразвуком в течение 15 с при 50 Гц с амплитудой 6 мкм, удерживая на льду с использованием Soniprep 150 (MSE, Лондон, Соединенное Королевство). Во время начальной оптимизации протокола также был протестирован короткий протокол, содержащий только стадию зимолиазы. Выделение спор подтверждали микроскопическим исследованием, как описано выше. Для прорастания споры промывали один раз YPD и затем ресуспендировали в 20 мл YPD до концентрации приблизительно 10 6 клеток на мл -1 . Прорастающую культуру инкубировали в круглодонной колбе на 100 мл при 30 ° C и 200 об / мин в течение 5 часов. Протокол с использованием разного времени инкубации в среде с 2% глюкозы и в YPD был протестирован во время начальной оптимизации межвидового скрещивания.

Окрашивание

сахаромицетов культур

Для окрашивания были приготовлены флуоресцентные красители CellTrace TM Violet, CellTrace TM CFSE и CellTrace TM Far Red (Thermo Fisher Scientific, Waltham, MA, США) в соответствии с рекомендациями производителей.Культуры окрашивали 2 мкл красителя CellTrace TM на мл культуры и инкубировали в течение ночи в темноте при 12 ° C и 200 об / мин. Окрашенные культуры дважды промывали средой YP, так как оставшиеся несвязанные молекулы красителя будут связываться с амидными группами в дрожжевом экстракте и пептоне.

Внутривидовое спаривание

гетероталлических гаплоидных родительских штаммов размножали до середины экспоненциальной фазы. Культуры двух родительских штаммов промывали и разводили в стерильном Isoton II (Beckman Coulter, Woerden, NL, США) до конечной плотности клеток приблизительно 10 6 клеток на мл -1 , окрашивали CellTrace TM Violet. или CellTrace TM CFSE и промывают для удаления несвязавшегося пятна.100 мкл каждой окрашенной культуры переносили в пробирку Эппендорфа и недолго центрифугировали (2000 g , 1 мин) для увеличения близости клеток для более эффективного спаривания. Затем спаривающуюся культуру статически инкубировали до 42 часов при 12 ° C в темноте до анализа FACS. Более длительная инкубация и более высокие температуры приводили к значительному ослаблению окрашивания из-за деления клеток.

Межвидовое спаривание и редкое спаривание

Диплоидных родительских штаммов и гетероталлических гаплоидных родительских штаммов размножали до середины экспоненциальной фазы.Гаплоидные родительские клетки из гомоталлических штаммов получали путем споруляции, выделения спор и прорастания. Клетки промывали и разводили в стерильном Isoton II (Beckman Coulter) до конечной плотности клеток приблизительно 10 6 клеток на мл -1 , окрашивали CellTrace TM Violet или CellTrace TM CFSE и промывали для удаления несвязанных клеток. пятно, как описано. Для редкого спаривания использовали конечную плотность клеток приблизительно 2 × 10 7 клеток, мл -1 , и клетки окрашивали CellTrace TM Far Red или CellTrace TM CFSE.100 мкл каждой окрашенной культуры переносили в пробирку Эппендорфа и недолго центрифугировали (2000 g , 1 мин) для увеличения близости клеток для более эффективного спаривания. Затем спаривающуюся культуру статически инкубировали до 30 часов при 12 ° C в темноте до анализа FACS. Более длительная инкубация и более высокие температуры приводили к значительному ослаблению окрашивания из-за деления клеток.

Анализ и сортировка FACS

Культуры для анализа и сортировки FACS разводили в стерильном Isoton II и тщательно встряхивали для разрушения агрегатов клеток.Для редкого спаривания добавляли 50 мМ ЭДТА для разрушения агрегатов клеток, образованных флокуляцией. Культуры анализировали на приборе BD FACSAria TM II SORP Cell Sorter (BD Biosciences, Франклин Лейкс, Нью-Джерси, США), оборудованном лазерами 355, 445, 488, 561 и 640 нм и соплом 70 мкм, и FACSFlow . Жидкость для оболочки TM (BD Biosciences). Правильная работа цитометра оценивалась перед каждым экспериментом путем запуска цикла настройки и отслеживания цитометра с использованием набора шариков CS&T (BD Biosciences) для калибровки.Задержка падения для сортировки определялась путем запуска цикла Auto Drop Delay с использованием Accudrop Beads (BD Biosciences). CellTrace TM Фиолетовую флуоресценцию возбуждали лазером 355 нм, а излучение регистрировали через полосовой фильтр 450 нм с полосой пропускания 50 нм. CellTrace TM CFSE возбуждали лазером 488 нм, и излучение регистрировалось через полосовой фильтр 545 нм с полосой пропускания 30 нм. CellTrace TM Far Red возбуждали лазером 640 нм, и излучение регистрировалось через полосовой фильтр 780 нм с полосой пропускания 60 нм.Морфологию клеток анализировали путем построения графика прямого рассеяния (FSC) против бокового рассеяния (SSC). Флуоресценцию скрещивающихся культур анализировали либо на графике CFSE против фиолетового, либо на графике CFSE против дальнего красного. Перед сортировкой было проанализировано не менее 10 5 событий. На этих участках были установлены области сортировки («ворота») для определения типов сортируемых ячеек. Закрытые одиночные клетки сортировали в 96-луночных микротитрационных планшетах, содержащих YPD, с использованием сортировочной маски «одиночных клеток» (0/32/16), и планшеты инкубировали при комнатной температуре в течение 2 дней.Когда использовали клетки с селектируемыми фенотипами, фракцию спарившихся клеток определяли путем высевания реплик на 96-луночные планшеты с селективной средой (SM или SM + G418) с использованием 96-штыревого репликатора, стерилизованного этанольным пламенем. Данные FACS анализировали с помощью программного обеспечения FlowJo ® (версия 3.05230, FlowJo, LLC, Ashland, OR, США).

Определение фракции растущих клеток

После сортировки FACS определяли долю растущих клеток путем подсчета количества лунок, в которых наблюдался рост.Для популяций с низкой жизнеспособностью было отсортировано до 1000 клеток на лунку, и статистика Пуассона была использована для оценки доли растущих клеток (Dube et al., 2008). Долю растущих клеток рассчитывали из (P), доли лунок, содержащих колонию, (W) общего количества лунок и (n), общего количества клеток, отсортированных в лунки (уравнение 1).

Доля растущих клеток = −ln (1 − P) * Wn (1)

Изображения

Клетки

визуализировали с помощью Zeiss Axio Imager Z1 (Carl Zeiss AG, Оберкохен, Германия).Для флуоресцентной визуализации клетки возбуждали ксеноновой лампой. Флуоресценцию CellTrace TM CFSE отображали через набор фильтров GFP (Carl Zeiss AG), содержащий полосовой фильтр возбуждения 470 нм с полосой пропускания 20 и эмиссионный фильтр 540 нм с полосой пропускания 25 нм. CellTrace TM Far Red отображали через набор фильтров Cy5 (Carl Zeiss AG), содержащий полосовой фильтр возбуждения 640 нм с полосой пропускания 30 нм и фильтр излучения 690 нм с полосой пропускания 50 нм.Изображения обрабатывали с помощью AxioVision SE64 (Rel. 4.9.1. Carl Zeiss AG) и FIJI (Schindelin et al., 2012).

Определение плоидности методом проточной цитометрии

Для определения плоидности образцы фиксировали этанолом, как описано ранее (Hebly et al., 2015). Окрашивание клеток зеленым красителем нуклеиновой кислоты SYTOX ® (Invitrogen) выполняли, как описано ранее (Haase and Reed, 2002), с некоторыми незначительными модификациями. Клетки промывали в 50 мМ Трис-HCl (pH 7,5) и ресуспендировали в 100 мкл раствора РНКазы (1 мг / мл РНКазы A в 50 мМ Трис-HCl).100 мкл клеток добавляли к 1 мл раствора SYTOX ® Green. При обработке большого количества образцов использовали высокопроизводительный протокол в 96-луночных микротитровальных планшетах с многоканальной электронной пипеткой PIPETMAN ® M (Gilson, Middleton, WI, США). В этом модифицированном протоколе 100 мкл образца фиксировали путем добавления 150 мкл 70% этанола, а на заключительном этапе 20 мкл образца добавляли к 180 мкл раствора SYTOX ® Green. Неокрашенный контроль был включен вместе с каждым образцом.Флуоресценцию образцов измеряли на проточном цитометре BD Accuri TM C6 CSampler (BD Biosciences). Флуорофор возбуждали лазером 488 нм проточного цитометра, и излучение регистрировали через полосовой фильтр 533 нм с шириной полосы 30 нм. Данные плоидности анализировали с использованием программного обеспечения FlowJo ® (версия 3.05230, FlowJo).

Идентификация межвидовых гибридов методом ПЦР

Наличие генетического материала от S. cerevisiae и от S.eubayanus и тип скрещивания потенциальных гибридов был подтвержден с помощью ПЦР с использованием DreamTaq PCR Mastermix (Life Technologies), как описано ранее (Hebly et al., 2015). Чтобы убедиться, что изоляты отдельных клеток были протестированы, отсортированные дважды окрашенные клетки выращивали в YPD, и второй этап FACS использовался для сортировки отдельных клеток из каждой культуры. ДНК из культур одноклеточных изолятов выделяли кипячением 2 мкл жидкой культуры в 2 мкл NaOH в течение 15 мин при 99 ° C. S. cerevisiae -специфический ген MEX67 был амплифицирован с использованием праймеров 8570 и 8571 (дополнительная таблица 1) и S.eubayanus -специфический ген FSY1 был амплифицирован с использованием праймеров 8572 и 8573 (Muir et al., 2011; Pengelly and Wheals, 2013). Тип спаривания определяли путем амплификации MAT -локусов с использованием праймеров 11, 12 и 13 (Huxley et al., 1990). Продукты ПЦР разделяли на 2% (мас. / Об.) Агарозном геле в 0,5X буфере TBE (45 мМ трис-борат, 1 мМ EDTA, pH 8).

Результаты

Изоляция внутривидовых гибридов из культуры спаривания с использованием FACS

Функциональный протокол для двойного окрашивания родительских штаммов, спаривания и сортировки на основе FACS дважды окрашенных клеток был разработан с использованием гетероталлического гаплоида S.cerevisiae штаммов CEN.PK113-5A ( MATa , His - , Lys - , Trp - ) и IMK439 ( MAT α, Ura - ). Благодаря их комплементарным ауксотрофиям, фракцию спарившихся клеток можно легко определить количественно до и после отбора дважды окрашенных клеток на основе FACS путем измерения способности роста на синтетической среде без гистидина, лизина, триптофана и урацила. CEN.PK113-5A и IMK439 окрашивали с использованием коммерчески доступных флуоресцентных красителей CellTrace TM CFSE и Violet соответственно.Эти красители ковалентно связываются с аминогруппами и тем самым необратимо маркируют родительские клетки (Filby et al., 2015). Затем спарившиеся клетки должны быть идентифицированы по присутствию флуоресцентного материала от обоих родительских штаммов. Эффективное окрашивание родительских штаммов было подтверждено для обоих красителей с помощью проточной цитометрии (рис. 1А). Чтобы свести к минимуму разведение красителя из-за деления клеток, окрашенные клетки скрещивали путем совместной инкубации в среде YPT при 12 ° C, что приводило к медленному росту S. cerevisiae .Проточная цитометрия спаривающейся культуры показала прогрессивное увеличение количества дважды окрашенных клеток с 0,90% через 18 часов до 5,25% через 42 часа (рис. 1А). Приблизительно 10% дважды окрашенных клеток имели морфологию (рис. 1В), характерную для зигот Saccharomyces (Herskowitz, 1988). Для определения доли спарившихся клеток клетки из общей популяции и из дважды окрашенной популяции были отсортированы по SM с использованием FACS. Только 4% от общей популяции смогли расти на SM, в то время как 74–82% дважды окрашенных клеток росли на этой среде, что указывает на 20-кратное обогащение спарившихся клеток в дважды окрашенной популяции (рис. 1C).

Рисунок 1. Внутривидовое спаривание S. cerevisiae штаммов CEN.PK113-5A ( MATa URA3 his3 1 leu2-3,112 trp1-289 ) и IMK439 ( MATα HIS3 TRP1 904U2 Δ :: KanMX ). (A) Контурные графики флуоресценции неокрашенных CEN.PK113-5A, CEN.PK113-5A, окрашенных CellTrace TM CFSE, IMK439, окрашенных CellTrace TM Violet, и культуры спаривания через 18, 24 и 42 года. час Указанные стробированные зоны использовались для сортировки ячеек, частота событий каждого строба указывается в процентах от общего количества ячеек. (B) Изображение под микроскопом (400 ×) зигот, отсортированных из популяции с двойным окрашиванием (C + V +) после 42 часов спаривания. (C) Процент клеток, способных расти на синтетической среде без добавок, дополняющих ауксотрофию, в различных популяциях, отсортированных с помощью FACS, как указано в (A) .

Выделение межвидовых гибридов из культуры спаривания с использованием FACS

Разработанный протокол применен для получения межвидовых гибридов между S. eubayanus штаммом CBS 12357 и S.cerevisiae , штамм IMK439 ( MATα, ura3 Δ :: KanMX ). Гибриды этих штаммов можно легко идентифицировать благодаря сочетанию прототрофности урацила и устойчивости к антибиотику G418. Поскольку CBS 12357 является гомоталлическим штаммом, он спорулировал перед окрашиванием и скрещиванием. Чтобы ограничить предвзятость к самоспариванию сестринских спор, был разработан протокол переваривания аскусного мешка на основе комбинированной обработки сурфактантом Тритон X-100 и зимолиазой (Herman and Rine, 1997) (дополнительный рисунок 1).При окрашивании изолированных спор S. eubayanus CBS 12357 примерно половина популяции не была флуоресцентно помечена после окрашивания и инкубации (дополнительная фигура 2). Поскольку краситель может не проникать через клеточную стенку споры, наблюдаемая потеря окрашивания может быть связана с потерей связанных флуорофоров во время прорастания, когда клеточная стенка споры утрачивается. Чтобы обеспечить эффективное прорастание спор при минимальном делении клеток перед окрашиванием, была реализована 5-часовая инкубация на YPD при 30 ° C (дополнительный рисунок 3).Используя протокол, который включал эти оптимизации, проросшие споры S. eubayanus CBS 12357, окрашенные CellTrace TM CFSE, были скрещены с гаплоидными клетками штамма S. cerevisiae IMK439, окрашенными фиолетовым красителем CellTrace TM (рис. 2A). . Поскольку отсутствие необходимости в потреблении трегалозы расширило бы применимость нашего метода, мы скрещивали клетки в YPD, а также в среде YPT при 12 ° C. Фракцию гибридизированных клеток контролировали во время спаривания путем сортировки дважды окрашенных клеток на YPD и определения фракции отсортированных клеток, которые могли расти на селективной среде (рис. 2В).Через 7 часов 1% дважды окрашенной популяции обеих спаривающихся культур на YPT и YPD был гибридным (рис. 2С). В отличие от внутривидового спаривания S. cerevisiae , спаривание на YPT не приводило к увеличению доли гибридов при длительной инкубации для межвидового спаривания. Однако в YPD доля гибридов среди дважды окрашенных клеток увеличилась до 18% через 24 часа и оставалась стабильной до 30 часов (рис. 2C). Напротив, после 30-часовой инкубации в YPD без сортировки только 0,3% от общей популяции смогли расти на селективной среде.Эти результаты показали, что сортировка дважды окрашенных клеток на основе FACS привела к 70-кратному обогащению межвидовых гибридов путем сортировки.

Рисунок 2. Оптимизация межвидовой гибридизации между гаплоидными штаммами S. eubayanus и S. cerevisiae . (A) Обзор оптимизированного протокола межвидового скрещивания спор с клетками. (B) Контурные графики флуоресценции скрещивающихся культур окрашенных спор CBS 12357 и клеток IMK439 через 30 часов скрещивания на YPD и YPT.Стробовые зоны использовались для сортировки ячеек, частота событий каждого строба указана в процентах. (C) Процент клеток в дважды окрашенной популяции, способных расти на SM + G418 после 3,5, 7, 24 и 30 часов инкубации на YPT (черный) и YPD (белый). Спаривание на YPT оценивали только через 7 и 30 часов.

Обогащение межвидовых гибридов без селектируемых фенотипов

Для проверки применимости протокола FACS с двойным флуоресцентным окрашиванием для выделения гибридов без селектируемых генетических маркеров, спор S.eubayanus CBS 12357 (Libkind et al., 2011) были скрещены с гаплоидным штаммом S. cerevisiae CEN.PK113-7D ( MATa ) (Entian and Kötter, 2007). Параллельно мы скрестили споры изолята тибетского S. eubayanus CDFM21L.1 (Bing et al., 2014) со спорами изолята Ale28 для пивоварения S. cerevisiae , предоставленного HEINEKEN Supply Chain. Эти диплоидные штаммы спорулировали и проращивали, как описано ранее (рис. 2А). С.eubayanus родителей окрашивали CellTrace TM CFSE, S. cerevisiae родителей - CellTrace TM Violet, и клетки совместно инкубировали в YPD в течение 30 часов при 12 ° C. Отдельные дважды окрашенные клетки сортировали в 96-луночные планшеты, содержащие 100 мкл YPD на лунку, и инкубировали при 30 ° C до полного роста культур (рис. 3A). Для исключения ложных срабатываний из-за совместной сортировки S. eubayanus / S. cerevisiae , по одной клетке из каждой лунки сортировали во второй 96-луночный планшет, содержащий YPD.После инкубации при 30 ° C наличие генетического материала от обоих родителей было подтверждено с помощью ПЦР-амплификации специфичного для S. cerevisiae гена MEX67 и S. eubayanus -специфического гена FSY1 (Muir et al. , 2011; Pengelly, Wheals, 2013). Для скрещивания CBS 12357 × CEN.PK113-7D полоса, соответствующая MEX67 и FSY1 , наблюдалась для 2 из 22 протестированных одноклеточных изолятов. Эти изоляты хранились как IMH001 и IMH002 (рис. 3C).Для скрещивания CDFM21L.1 × Ale28 полоса, соответствующая MEX67 и FSY1 , была получена для 5 из 34 протестированных одноклеточных изолятов, которые хранились как IMH003-IMH007 (Рисунок 3C). Чтобы проверить, являются ли штаммы IMH001-IMH007 гибридами, а не смесями гаплоидных клеток S. cerevisiae и S. eubayanus , плоидность отсортированных клеток определяли путем окрашивания ДНК с использованием SYTOX Green и проточного цитометрического анализа. Геномное содержание IMH001-IMH006 было диплоидным, тогда как IMH007 было анеуплоидным (рис. 3B), что указывает на успешное спаривание.Следовательно, 9% протестированных клеток от скрещивания CBS 12357 и CEN.PK113-7D и 15% клеток от спаривания между CDFM21L.1 и Ale28 были гибридами. Эти результаты показывают, что флуоресцентное окрашивание и FACS позволяют существенно обогатить гибридные клетки как для лабораторных, так и для промышленных штаммов. Простого протокола ПЦР было достаточно для идентификации гибридов после обогащения.

Рисунок 3. Обогащение межвидовых гибридов без селектируемых фенотипов из CBS 12357 ( S.eubayanus , спорулированный) и CEN.PK113-7D ( MATa ) и из CDFM21L.1 ( S. eubayanus , спорулированный) и Ale28 ( S. cerevisiae , спорулированный). (A) Контурные графики флуоресценции спаривающихся культур между CBS 12357 (CFSE) × CEN.PK113-7D (фиолетовый) и CDFM21L.1 (CFSE) × Ale28 (фиолетовый). Для сортировки ячеек использовались закрытые зоны, частота событий каждого прохода указана в процентах от общей численности популяции. (B) Проточная цитометрическая количественная оценка содержания генома сконструированных гибридов с использованием окрашивания SYTOX Green. S. cerevisiae. штаммов CEN.PK113-7D и CEN.PK122 использовали в качестве гаплоидного и диплоидного контроля соответственно. (C) Мультиплексная ПЦР-амплификация гена S. cerevisiae , специфичного для MEX67 (150 п.н.) и гена S. eubayanus , специфичного для FSY1 (228 п.н.) в одноклеточных изолятах дважды окрашенных популяции из спаривающихся культур CBS 12357 × CEN.PK113-7D и CDFM21L.1 × Ale28. Для CBS 12357 × CEN.PK113-7D показаны 4 из 22 протестированных изолятов.В качестве контролей использовали геномную ДНК S. cerevisiae, Ale26, S. eubayanus, CDFM21L.1 и S. cerevisiae, × , S. eubayanus IMS0408. Гибридные изоляты обозначены стрелками. L: Генерулер 50 п.н. ДНК-лестницы.

Обогащение межвидовых гибридов путем редкого спаривания

Полиплоидия и анеуплоидия обычно наблюдаются у промышленных гибридов Saccharomyces (González et al., 2006; Querol and Bond, 2009; Peris et al., 2012), а количество копий хромосом может играть ключевую роль в производственных показателях (Krogerus et al. al., 2016; Гортер де Фрис и др., 2017b). Низкая эффективность споруляции многих промышленных штаммов может препятствовать гибридизации путем обычного скрещивания (Anderson and Martin, 1975). Мы исследовали использование двойного флуоресцентного окрашивания и FACS для обогащения гибридов, полученных в результате редкого спаривания, путем тестирования комбинаций гаплоидных и диплоидных штаммов S. eubayanus и S. cerevisiae . Для оценки низких фракций гибридных клеток мы использовали штаммов S. eubayanus с прототрофией урацила и S.cerevisiae с ауксотрофией по урацилу и устойчивостью к антибиотику G418. Чтобы получить диплоидный штамм S. cerevisiae с ауксотрофией урацила и устойчивостью к антибиотику G418, мы сначала скрестили IMK439 ( MATα ura 3Δ :: KanMX) и IMK440 ( MATa ura3 Δ :: Kan fluMores ). окрашивание и FACS с получением IMX1471 ( MATa / MATα, ura3 Δ :: KanMX / ura3 Δ :: KanMX ). Были проверены типы спаривания, плоидность, способность образовывать споры, прототрофия урацила и устойчивость IMX1471 к G418 (дополнительная фигура 4).Из-за ожидаемой низкой частоты спаривания клеток S. eubayanus были окрашены CellTrace TM CFSE и S. cerevisiae клетки CellTrace TM Far Red, поскольку эти красители имеют небольшое спектральное перекрытие (дополнительный рисунок 4). ). Всего было сделано три разных скрещивания: CBS 12357 (спорулированный, 1n) × IMX1471 (2n), CBS 12357 (2n) × IMK439 (1n) и CBS 12357 (2n) × IMX1471 (2n). Частоту гибридных клеток в каждой культуре спаривания оценивали путем посева 2 × 10 8 клеток на планшеты SM + G418 и подсчета колоний.Параллельно спаривающуюся культуру анализировали с помощью FACS, и дважды окрашенные клетки сортировали и наносили на реплики SM + G418 для определения частоты гибридных клеток после сортировки. Из-за низкой частоты редких спариваний лунки инокулировали 1, 10 или 100 дважды окрашенными клетками и рассчитывали долю растущих клеток с использованием статистики Пуассона.

Для скрещивания CBS 12357 (2n) × IMK439 (1n) доля гибридов в общей популяции варьировала от 1,6 × 10 -6 до 7.2 × 10 −6 между 24 и 168 часами. После сортировки доля увеличилась в среднем в 590 раз до значений от 4,3 × 10 −4 до 1,3 × 10 −3 (Таблица 2). Для скрещивания CBS 12357 (1n) × IMX1471 (2n) доля гибридов в общей популяции варьировала от 3 × 10 −7 до 1,5 × 10 −6 между 24 и 168 часами. Сортировка дала только один гибрид через 96 часов с долей 4,3 × 10 -4 , что соответствует 540-кратному обогащению.Для скрещивания CBS 12357 (2n) × IMX1471 (2n) один гибрид наблюдали через 96 ч инкубации, что соответствует скорости 1 × 10 -7 , в то время как после сортировки гибриды не были идентифицированы. В целом, хотя между гаплоидными и диплоидными штаммами было возможно редкое спаривание, спаривающиеся клетки присутствовали с очень низкой частотой как в спаривающихся культурах, так и в дважды окрашенных клетках. Теоретически флуоресцентное окрашивание и FACS можно сочетать с высокопроизводительным ПЦР-скринингом гибридов в отсортированной популяции.Однако сотни клеток должны быть подвергнуты скринингу на диплоидный кросс CBS 12357 × гаплоид IMK439 и даже больше на другие скрещивания.

Таблица 2. Фракция гибридных клеток после редкого межвидового спаривания между S. eubayanus, штамм CBS 12357 и S. cerevisiae, штаммы IMK439 (1n) и IMX1471 (2n), как определено по способности расти на SM + G418 .

Обсуждение

Это исследование представляет новый метод обогащения межвидовых гибридов Saccharomyces , который не требует, чтобы родительские штаммы и / или полученные гибриды имели селектируемые фенотипы.Путем двойного окрашивания родительских клеток коммерчески доступными флуоресцентными красителями перед скрещиванием спарившиеся клетки могут быть обогащены до 600 раз за счет сортировки дважды окрашенных клеток с использованием FACS. Чтобы иметь возможность скрещивать гомоталлические штаммы, мы разработали протокол споруляции и прорастания до окрашивания. Дважды окрашенные субпопуляции, отобранные с помощью FACS после применения этого протокола, содержали около 80% спарившихся клеток для внутривидовых скрещиваний и 10-15% спарившихся клеток для межвидовой гибридизации.Путем скрининга отсортированных дважды окрашенных клеток с помощью ПЦР были успешно выделены гибриды от скрещиваний лабораторных штаммов и промышленно значимых штаммов, не имевших селектируемых фенотипов. Путем обхода необходимости в традиционных методах гибридизации для уже существующих или сконструированных селектируемых фенотипов (Pérez-Través et al., 2012; da Silva et al., 2015; Fernández-González et al., 2015; Krogerus et al., 2015) этот метод позволяет изолировать гибриды от широкого спектра штаммов всего за несколько дней.Межвидовые гибриды были получены ранее флуоресцентным окрашиванием и слиянием протопластов (Katsuragi et al., 1994). Однако, хотя в некоторых странах слияние протопластов рассматривается как ГМ-метод, гибридизация путем спаривания - нет, что делает его пригодным для применения в глобальной индустрии продуктов питания и напитков (Gibson et al., 2017). Использование окрашивания не представляет проблем для промышленного применения, поскольку оно быстро теряется при разбавлении во время последующего деления гибридных клеток (Filby et al., 2015).

Выделение межвидовых гибридов с использованием флуоресцентного мечения и FACS открывает новые возможности для использования лабораторных гибридов для таких применений, как производство ферментированных напитков и биотоплива (Bellon et al., 2011, 2015; Mertens et al., 2015; Magalhães et al., 2017; Peris et al., 2017). Поскольку физиология гибридов сильно зависит от комбинации родительских штаммов (Mertens et al., 2015; Krogerus et al., 2017b), возможность скрещивания штаммов без какого-либо селектируемого фенотипа может расширить фенотипическое разнообразие лабораторных гибридов.Условия прорастания, окрашивания и / или спаривания можно оптимизировать с учетом характеристик конкретных родительских штаммов, таких как температурный оптимум, использование углеводов и кинетика роста. В будущем массовое скрещивание более двух родительских штаммов с флуоресцентной меткой может расширить фенотипическое разнообразие полученных лабораторных гибридов. Из-за неспособности многих промышленных штаммов производить жизнеспособные споры (Steensels et al., 2014b), а также из-за потенциальной ценности гибридов с более высокой плоидностью (Krogerus et al., 2016; Gorter de Vries et al., 2017b), выделение межвидовых гибридов путем редкого спаривания также было бы ценным для развития промышленных штаммов. Хотя флуоресцентная маркировка и FACS действительно позволили в 600 раз увеличить количество межвидовых гибридов, полученных путем редкого спаривания, для выделения гибридов потребуется тщательный скрининг из-за высокой частоты ложноположительных результатов. Присутствие обоих красителей практически во всех отсортированных клетках, подтвержденное микроскопией, показало, что ложноположительные результаты не связаны с нежелательной совместной сортировкой отдельных окрашенных клеток.Вместо этого окрашивание может переноситься между клетками, не приводя к гибридным клеткам. Из-за ковалентного связывания красителей такой перенос, вероятно, будет включать перенос значительных количеств клеточных компонентов, таких как клеточная мембрана или цитоплазма. Такой перенос может быть результатом абортивного спаривания или цитодукции, что приводит к цитоплазматическому слиянию без ядерного слияния и, вероятно, будет увеличиваться по частоте по мере снижения эффективности спаривания (Sigurdson et al., 1981). Однако скрининг сотен кандидатов на основе ПЦР возможен в программах улучшения промышленных штаммов.Более того, разработка высокопроизводительных методов, таких как микрофлюидная лаборатория-на-чипе, может еще больше упростить скрининг после FACS-сортировки редких гибридов (Schmitz et al., 2009; Gach et al., 2017).

Состав генома и стабильность лабораторных гибридов широко исследованы (Sipiczki, 2018). Однако способность создавать разнообразные межвидовые гибриды с использованием флуоресцентного мечения может упростить текущие исследования, например, специфических для гибридов явлений, таких как гетерозис (Shapira et al., 2014; Bernardes et al., 2017), наследование митохондриальной ДНК у гибридов (Hsu and Chou, 2017), стабильность генома и потеря гетерозиготности (Smukowski Heil et al., 2017) или стерильность гибрида (Greig et al., 2002; Lee и др., 2008). В целом, представленная здесь процедура межвидового скрещивания может значительно ускорить программы улучшения промышленных штаммов и фундаментальные исследования гибридных дрожжей. Более того, описанный метод может дополнять последующее улучшение штамма: лабораторная эволюция может привести к смешиванию родительских геномов, что приведет к дальнейшей адаптации и потенциально к повышению производительности, аналогично смешанным геномам промышленных химерных штаммов (Pérez Través et al., 2014; Peris et al., 2017; Гортер де Фрис и др., 2019).

Доступность данных

Необработанные данные, подтверждающие выводы этой рукописи, будут предоставлены авторами без излишних оговорок любому квалифицированному исследователю.

Авторские взносы

Авторы исследования -

AG и J-MD. AG, CK, SW и ML разработали экспериментальные подходы. CK, SW и AG выполнили экспериментальные работы. NK и J-MG предоставили штамм ALE28 и поддержали проект. AG и CK написали рукопись при критическом участии JP и J-MD.JP и J-MD контролировали исследование. Все авторы прочитали и одобрили окончательную рукопись.

Финансирование

Эта работа была выполнена в рамках программы исследований и разработок BE-Basic, на которую была выделена субсидия FES от голландского Министерства экономики, сельского хозяйства и инноваций (EL&I) (TKIBE01003 и TKIBE01001).

Заявление о конфликте интересов

AG, CK, NK, J-MG и J-MD подали заявку на патент в отношении этой работы. NK и J-MG работают в сети поставок Heineken B.В. (Зетервоуде, Нидерланды).

Остальные авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы хотели бы поблагодарить профессора Фен-Янга Бая (Китайская академия наук) за любезно предоставленный нам CDFM21L.1 и Ксавьера Хаккарта (Делфтский технологический университет) за его опыт и поддержку в области флуоресцентной микроскопии.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https: // www.frontiersin.org/articles/10.3389/fmicb.2019.00871/full#supplementary-material

Список литературы

Александр, В. Г., Перис, Д., Пфанненштиль, Б. Т., Опуленте, Д. А., Куанг, М., и Хиттингер, К. Т. (2016). Эффективная разработка безмаркерных синтетических аллотетраплоидов Saccharomyces . Fungal Genet. Биол. 89, 10–17. DOI: 10.1016 / j.fgb.2015.11.002

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Алмейда, П., Гонсалвес, К., Teixeira, S., Libkind, D., Bontrager, M., Masneuf-Pomarède, I., et al. (2014). Гондванский след в глобальном разнообразии и приручении винных и сидровых дрожжей Saccharomyces uvarum . Nat. Commun. 5: 4044. DOI: 10.1038 / ncomms5044

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Андерсон Э. и Мартин П. (1975). Спороношение и спаривание пивных дрожжей. J. Inst. Заварить. 81, 242–247. DOI: 10.1002 / j.2050-0416.1975.tb03685.х

CrossRef Полный текст | Google Scholar

Бахалул М., Канети Г. и Каши Ю. (2010). Процедура выделения аскоспор эфир-зимолиазой: эффективный протокол выделения аскоспор у дрожжей Saccharomyces cerevisiae . Дрожжи 27, 999–1003. DOI: 10.1002 / yea.1808

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Балат, М. (2011). Производство биоэтанола из лигноцеллюлозных материалов биохимическим путем: обзор. Energy Convers. Manag. 52, 858–875. DOI: 10.1016 / j.enconman.2010.08.013

CrossRef Полный текст | Google Scholar

Банно И. и Канеко Ю. (1989). Генетический анализ таксономической связи между Saccharomyces cerevisiae и Saccharomyces bayanus . Дрожжи 5, S373 – S377.

PubMed Аннотация | Google Scholar

Белл, П. Дж., Дир, Д., Шен, Дж., Чепмен, Б., Биссинджер, П. Х., Аттфилд, П. В. и др. (1998).Метод проточной цитометрии для быстрого отбора новых промышленных гибридов дрожжей. Заявл. Environ. Microbiol. 64, 1669–1672.

PubMed Аннотация | Google Scholar

Беллох, К., Орлик, С., Баррио, Э. и Кверол, А. (2008). Адаптация к ферментативному стрессу гибридов в составе комплекса Saccharomyces sensu stricto . Внутр. J. Food Microbiol. 122, 188–195. DOI: 10.1016 / j.ijfoodmicro.2007.11.083

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Беллон, Дж.Р., Эглинтон, Дж. М., Зиберт, Т. Э., Польниц, А. П., Роуз, Л., Де Баррос Лопес, М. и др. (2011). Новые межвидовые гибриды винных дрожжей придают винам разнообразие вкусов и ароматов. Заявл. Microbiol. Biotechnol. 91, 603–612. DOI: 10.1007 / s00253-011-3294-3

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Беллон, Дж. Р., Шмид, Ф., Капоне, Д. Л., Данн, Б. Л., и Чемберс, П. Дж. (2013). Представляем новую породу винных дрожжей: межвидовая гибридизация между коммерческими винными дрожжами Saccharomyces cerevisiae и Saccharomyces mikatae . PLoS One 8: e62053. DOI: 10.1371 / journal.pone.0062053

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Беллон, Дж. Р., Янг, Ф., Дэй, М. П., Инглис, Д. Л., и Чемберс, П. Дж. (2015). Разработка и создание межвидовых гибридов Saccharomyces для улучшенных отраслевых фенотипов. Заявл. Microbiol. Biotechnol. 99, 8597–8609. DOI: 10.1007 / s00253-015-6737-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бинг, Дж., Han, P.-J., Liu, W.-Q., Wang, Q.-M., and Bai, F.-Y. (2014). Доказательства дальневосточно-азиатского происхождения дрожжей для лагерного пива. Curr. Биол. 24, R380 – R381. DOI: 10.1016 / j.cub.2014.04.031

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Боке, Дж. Д., Трухарт, Дж., Нацулис, Г., и Финк, Г. Р. (1987). 5-Фтороротовая кислота как селективный агент в молекулярной генетике дрожжей. Methods Enzymol. 154, 164–175. DOI: 10.1016 / 0076-6879 (87) 54076-9

CrossRef Полный текст | Google Scholar

Ченг Т.-Х., Чанг, Ч.-Р., Джой, П., Яблок, С., и Гартенберг, М. Р. (2000). Контроль экспрессии генов в дрожжах путем индуцируемой сайт-специфической рекомбинации. Nucleic Acids Res. 28: e108.

Google Scholar

Колоретти Ф., Замбонелли К. и Тини В. (2006). Характеристика флокулянтов Saccharomyces межвидовых гибридов для производства игристых вин. Food Microbiol. 23, 672–676. DOI: 10.1016 / j.fm.2005.11.002

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кормак, Б.П., Вальдивия Р. Х. и Фалькоу С. (1996). Оптимизированные для FACS мутанты зеленого флуоресцентного белка (GFP). Ген 173, 33–38. DOI: 10.1016 / 0378-1119 (95) 00685-0

CrossRef Полный текст | Google Scholar

da Silva, T., Albertin, W., Dillmann, C., Bely, M., La Guerche, S., Giraud, C., et al. (2015). Гибридизация в пределах рода Saccharomyces приводит к гомеостазу и фенотипической новизне в условиях виноделия. PLoS One 10: e0123834. DOI: 10.1371 / journal.pone.0123834

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дубе С., Цинь Дж. И Рамакришнан Р. (2008). Математический анализ изменения числа копий в образце ДНК с помощью цифровой ПЦР на наножидкостном устройстве. PLoS One 3: e2876. DOI: 10.1371 / journal.pone.0002876

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Данн, Б., Рихтер, К., Квитек, Д. Дж., Пью, Т., и Шерлок, Г. (2012). Анализ пангенома Saccharomyces cerevisiae показывает пул вариантов числа копий, распределенных в различных штаммах дрожжей из различных промышленных сред. Genome Res. 22, 908–924. DOI: 10.1101 / gr.130310.111

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Энтиан, К.-Д., и Кёттер, П. (2007). 25 Генетический штамм дрожжей и коллекции плазмид. Methods Microbiol. 36, 629–666. DOI: 10.1016 / s0580-9517 (06) 36025-4

CrossRef Полный текст | Google Scholar

Фернандес-Гонсалес, М., Убеда, Х. Ф., и Брионес, А. И. (2015). Изучение винных штаммов Saccharomyces cerevisiae для селекции с помощью анализа эффективности ферментации и тетрадного анализа. Curr. Microbiol. 70, 441–449. DOI: 10.1007 / s00284-014-0741-2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Филби А., Бегум Дж., Джалал М. и Дэй В. (2015). Оценка пригодности сукцинимидиловых и липофильных флуоресцентных красителей для отслеживания пролиферации в не покоящихся клетках путем разбавления красителя. Методы 82, 29–37. DOI: 10.1016 / j.ymeth.2015.02.016

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гач, П.К., Иваи, К., Ким, П., Хиллсон, Н., Сингх, А. К. (2017). Капельная микрофлюидика для синтетической биологии. Lab Chip 17, 3388–3400. DOI: 10.1039 / c7lc00576h

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гибсон, Б., Гиртман, Ж.-М. А., Хиттингер, К. Т., Крогерус, К., Либкинд, Д., Луис, Э. Дж. И др. (2017). Новые дрожжи - новые сорта пива: современные подходы к созданию и разработке пивоваренных дрожжей. FEMS Yeast Res. 17: fox038. DOI: 10.1093 / femsyr / fox038

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гольдштейн, А.Л. и Маккаскер Дж. Х. (1999). Три новых кассеты доминантной лекарственной устойчивости для разрушения гена в Saccharomyces cerevisiae . Дрожжи 15, 1541–1553. DOI: 10.1002 / (sici) 1097-0061 (199910) 15:14 <1541 :: help-yea476> 3.3.co; 2-b

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гонсалес, С. С., Баррио, Э., Гафнер, Дж., И Кверол, А. (2006). Природные гибриды из Saccharomyces cerevisiae , Saccharomyces bayanus и Saccharomyces kudriavzevii при ферментации вин. FEMS Yeast Res. 6, 1221–1234.

PubMed Аннотация | Google Scholar

Гонсалес-Рамос, Д., Ван Ден Брук, М., Ван Марис, А. Дж. А., Пронк, Дж. Т., и Даран, Ж.-М. Г. (2013). Геномный анализ толерантности к бутанолу у Saccharomyces cerevisiae показывает важную роль деградации белка. Biotechnol. Биотопливо 6:48. DOI: 10.1186 / 1754-6834-6-48

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гортер де Фрис, А.Р., Грут П. А., Брук М. и Даран Ж.-М. Г. (2017а). CRISPR-Cas9 опосредованные делеции генов в лагерных дрожжах Saccharomyces pastorianus . Microb. Cell Fact. 16: 222. DOI: 10.1186 / s12934-017-0835-1

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гортер де Фрис, А. Р., Пронк, Дж. Т., и Даран, Ж.-М. Г. (2017б). Промышленная значимость вариации числа копий хромосом у дрожжей Saccharomyces . Заявл. Environ. Microbiol. 83: e03206-16. DOI: 10.1128 / AEM.03206-16

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гортер де Фрис, А. Р., Воскамп, М., Ван Алст, А. К., Кристенсен, Л. Х., Янсен, Л., Ван ден Брук, М., и др. (2019). Лабораторная эволюция гибрида Saccharomyces cerevisiae x S. eubayanus в имитированных условиях пивоварения лагера. Фронт. Genet. 10: 242. DOI: 10.3389 / fgene.2019.00242

CrossRef Полный текст | Google Scholar

Гунге, Н.и Накатоми Ю. (1972). Генетические механизмы редких спариваний дрожжей Saccharomyces cerevisiae , гетерозиготных по типу спаривания. Генетика 70, 41–58.

PubMed Аннотация | Google Scholar

Hebly, M., Brickwedde, A., Bolat, I., Driessen, M. R. M., De Hulster, E. A. F., Van Den Broek, M., et al. (2015). S. cerevisiae × Межвидовой гибрид S. eubayanus , лучшее как в мире, так и за его пределами. FEMS Yeast Res. 15: fov005.DOI: 10.1093 / femsyr / fov005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Герман П. К. и Райн Дж. (1997). Прорастание спор дрожжей: потребность в активности белка Ras во время повторного входа в клеточный цикл. EMBO J. 16, 6171–6181. DOI: 10.1093 / emboj / 16.20.6171

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Hou, J., Friedrich, A., De Montigny, J., and Schacherer, J. (2014). Хромосомные перестройки как главный механизм начала репродуктивной изоляции у Saccharomyces cerevisiae . Curr. Биол. 24, 1153–1159. DOI: 10.1016 / j.cub.2014.03.063

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Hsu, Y.-Y., and Chou, J.-Y. (2017). Факторы окружающей среды могут влиять на митохондриальную наследование у гибридов дрожжей Saccharomyces . PLoS One 12: e0169953. DOI: 10.1371 / journal.pone.0169953

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Янсен, М. Л., Брахер, Дж. М., Папапетридис, И., Verhoeven, M. D., De Bruijn, H., De Waal, P. P. P. и др. (2017). Saccharomyces cerevisiae штаммов для производства этанола второго поколения: от научных исследований до промышленного внедрения. FEMS Yeast Res. 17: fox044. DOI: 10.1093 / femsyr / fox044

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хименес А. и Дэвис Дж. (1980). Экспрессия мобильного элемента устойчивости к антибиотикам в Saccharomyces . Природа 287, 869–871.DOI: 10.1038 / 287869a0

CrossRef Полный текст | Google Scholar

Кацураги Т., Кавабата Н. и Сакаи Т. (1994). Отбор гибридов из протопластов слияния дрожжей методом двойной флуоресцентной метки и автоматической сортировки клеток. Lett. Прил. Microbiol. 19, 92–94. DOI: 10.1111 / j.1472-765x.1994.tb00913.x

CrossRef Полный текст | Google Scholar

Krogerus, K., Arvas, M., De Chiara, M., Magalhães, F., Mattinen, L., Oja, M., et al. (2016).Плоидность влияет на функциональные признаки гибридов лагерных дрожжей de novo . Заявл. Microbiol. Biotechnol. 100, 7203–7222. DOI: 10.1007 / s00253-016-7588-3

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Крогерус, К., Магальяйнс, Ф., Видгрен, В., и Гибсон, Б. (2015). Новые штаммы лагерных дрожжей, полученные в результате межвидовой гибридизации. J. Ind. Microbiol. Biotechnol. 42, 769–778. DOI: 10.1007 / s10295-015-1597-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Крогерус, К., Магальяйнс, Ф., Видгрен, В., Гибсон, Б. (2017a). Новые гибриды пивоваренных дрожжей: создание и применение. Заявл. Microbiol. Biotechnol. 101, 65–78. DOI: 10.1007 / s00253-016-8007-5

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Крогерус К., Сеппянен-Лааксо Т., Кастильо С. и Гибсон Б. (2017b). Наследование фенотипов, относящихся к пивоварению, у сконструированных гибридов Saccharomyces cerevisiae × Saccharomyces eubayanus . Microb.Cell Fact. 16:66. DOI: 10.1186 / s12934-017-0679-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Lee, H.-Y., Chou, J.-Y., Cheong, L., Chang, N.-H., Yang, S.-Y., and Leu, J.-Y. (2008). Несовместимость ядерного и митохондриального геномов вызывает стерильность гибридов между двумя видами дрожжей. Cell 135, 1065–1073. DOI: 10.1016 / j.cell.2008.10.047

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Либкинд, Д., Хиттингер, К.T., Valério, E., Gonçalves, C., Dover, J., Johnston, M., et al. (2011). Одомашнивание микробов и идентификация дикого генетического материала лагерных дрожжей. Proc. Natl. Акад. Sci. США 108, 14539–14544. DOI: 10.1073 / pnas.1105430108

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лопандич, К., Пфлиглер, В. П., Тифенбруннер, В., Гангл, Х., Сипицки, М., и Стерфлингер, К. (2016). Генотипическая и фенотипическая эволюция межвидовых гибридов дрожжей при ферментации с высоким содержанием сахара. Заявл. Microbiol. Biotechnol. 100, 6331–6343. DOI: 10.1007 / s00253-016-7481-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Magalhães, F., Krogerus, K., Vidgren, V., Sandell, M., and Gibson, B. (2017). Улучшенная производительность и качество ферментации сидра с использованием недавно созданных гибридов Saccharomyces cerevisiae × Saccharomyces eubayanus . J. Ind. Microbiol. Biotechnol. 44, 1203–1213. DOI: 10.1007 / s10295-017-1947-7

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Маснеф-Помаред, I., Мурат, М.-Л., Наумов, Г.И., Томинага, Т., и Дубурдье, Д. (2002). Гибриды Saccharomyces cerevisiae x Saccharomyces bayanus var. uvarum , обладающий высокой высвобождающей способностью некоторых сортовых ароматов серы из вин Vitis vinifera Sauvignon blanc . J. Int. Sci. Винь Вин 36, 205–212.

Google Scholar

Мертенс, С., Стинселс, Дж., Саельс, В., Де Рук, Г., Аэртс, Г., Верстрепен, К. Дж. (2015). Большой набор недавно созданных межвидовых гибридов Saccharomyces увеличивает ароматическое разнообразие лагерного пива. Заявл. Environ. Microbiol. 81, 8202–8214. DOI: 10.1128 / AEM.02464-15

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мьюир А., Харрисон Э. и Уилс А. (2011). Мультиплексный набор видоспецифичных праймеров для быстрой идентификации представителей рода Saccharomyces . FEMS Yeast Res. 11, 552–563. DOI: 10.1111 / j.1567-1364.2011.00745.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Наумов, Г.(1996). Генетическая идентификация биологических видов в комплексе Saccharomyces sensu stricto . J. Ind. Microbiol. 17, 295–302. DOI: 10.1007 / bf01574704

CrossRef Полный текст | Google Scholar

Наумов Г. И., Наумова Е. С., Маснеф И., Эгль М., Кондратьева В. И., Дубурдье Д. (2000). Естественная полиплоидизация некоторых культурных дрожжей Saccharomyces sensu stricto : ауто- и аллотетраплоидия. Syst. Прил. Microbiol. 23, 442–449.DOI: 10.1016 / s0723-2020 (00) 80076-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Наумов, Г. И., Нгуен, Х.-В., Наумова, Э. С., Мишель, А., Эгль, М., и Гайярдин, К. (2001). Генетическая идентификация Saccharomyces bayanus var. uvarum , дрожжи для брожения сидра. Внутр. J. Food Microbiol. 65, 163–171. DOI: 10.1016 / s0168-1605 (00) 00515-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Наумова, Э.С., Наумов Г. И., Михайлова Ю. В., Мартыненко Н. Н., Маснеф-Помаред И. (2011). Исследование генетического разнообразия дрожжей Saccharomyces bayanus var. uvarum обнаруживает интрогрессированные субтеломерные гены Saccharomyces cerevisiae . Res. Microbiol. 162, 204–213. DOI: 10.1016 / j.resmic.2010.09.023

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Никулин Дж., Крогерус К., Гибсон Б. (2017). Альтернатива Межвидовые гибридные комбинации Saccharomyces и их потенциал для низкотемпературной ферментации сусла. Дрожжи 35, 113–127. DOI: 10.1002 / yea.3246

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Никулин, Дж., Крогерус, К., Гибсон, Б. (2018). Альтернатива Межвидовые гибридные комбинации Saccharomyces и их потенциал для низкотемпературной ферментации сусла. Дрожжи 35, 113–127.

PubMed Аннотация | Google Scholar

Нуэно-Палоп, К., Бонд, К. Дж., Макги, Х., Робертс, И. Н., и Делнери, Д. (2017). Saccharomyces jurei sp.nov., Выделение и генетическая идентификация нового вида дрожжей из Quercus robur . Внутр. J. Syst. Evol. Microbiol. 67, 2046–2052. DOI: 10.1099 / ijsem.0.002013

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Перес Травес, Л., Лопес, К. А., Баррио Эспардусер, Э., и Керол Симон, А. (2014). Процесс стабилизации Saccharomyces внутри- и межвидовых гибридов в условиях ферментации. Внутр. Microbiol. 17, 213–224.DOI: 10.2436 / 20.1501.01.224

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Перес-Травес, Л., Лопес, К. А., Баррио, Э., и Кероль, А. (2012). Оценка различных генетических процедур для создания искусственных гибридов в виноделии рода Saccharomyces . Внутр. J. Food Microbiol. 156, 102–111. DOI: 10.1016 / j.ijfoodmicro.2012.03.008

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Перис, Д., Беллох, К., Лопандич, К., Альварес-Перес, Дж. М., Кероль, А., и Баррио, Э. (2012). Молекулярная характеристика новых типов гибридных дрожжей Saccharomyces cerevisiae × S. kudriavzevii показывает высокое генетическое разнообразие. Дрожжи 29, 81–91. DOI: 10.1002 / yea.2891

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Перис Д., Мориарти Р. В., Александер В. Г., Бейкер Э., Сильвестр К., Сарди М. и др. (2017). Гибридизация и адаптивная эволюция различных видов Saccharomyces для производства целлюлозного биотоплива. Biotechnol. Биотопливо 10:78. DOI: 10.1186 / s13068-017-0763-7

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Питер, Дж., Де Кьяра, М., Фридрих, А., Юэ, Ж.-Х., Пфлигер, Д., Бергстрём, А., и др. (2018). Эволюция генома 1011 изолятов Saccharomyces cerevisiae . Природа 556, 339–344. DOI: 10.1038 / s41586-018-0030-5

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Pfliegler, W. P., Antunovics, Z., и Сипицки, М. (2012). Двойной барьер стерильности между видами Saccharomyces и его разрушение у аллополиплоидных гибридов в результате потери хромосом. FEMS Yeast Res. 12, 703–718. DOI: 10.1111 / j.1567-1364.2012.00820.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пиотровски, Дж. С., Нагараджан, С., Кролл, Э., Стэнбери, А., Чиотти, К. Э., Крюкеберг, А. Л. и др. (2012). Различное давление отбора приводит к разным геномным результатам по мере развития новообразованных гибридных дрожжей. BMC Evol. Биол. 12:46. DOI: 10.1186 / 1471-2148-12-46

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Райниери С., Кодама Ю., Канеко Ю., Миката К., Накао Ю. и Асикари Т. (2006). Чистые и смешанные генетические линии Saccharomyces bayanus и Saccharomyces pastorianus и их вклад в геном штамма для пивоварения лагера. Заявл. Environ. Microbiol. 72, 3968–3974. DOI: 10.1128 / aem.02769-05

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Салазар, А.Н., Гортер де Фрис, А. Р., Ван ден Брук, М., Вейсман, М., Де ла Торре Кортес, П., Брикведде, А. и др. (2017). Секвенирование нанопор обеспечивает почти полную сборку de novo эталонного штамма Saccharomyces cerevisiae CEN.PK113-7D. FEMS Yeast Res. 17: fox074. DOI: 10.1093 / femsyr / fox074

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сато М., Кишимото М., Ватари Дж. И Такасио М. (2002). Селекция пивных дрожжей путем гибридизации между дрожжами верхового брожения Saccharomyces cerevisiae и криофильными дрожжами Saccharomyces bayanus . J. Biosci. Bioeng. 93, 509–511. DOI: 10.1263 / jbb.93.509

CrossRef Полный текст | Google Scholar

Сканнелл, Д. Р., Зилл, О. А., Рокас, А., Пайен, К., Данхэм, М. Дж., Эйзен, М. Б. и др. (2011). Потрясающая сила эволюционной генетики дрожжей: новые последовательности генома и ресурсы штаммов для рода Saccharomyces sensu stricto . G3 1, 11–25. DOI: 10.1534 / g3.111.000273

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шинделин, Дж., Arganda-Carreras, I., Frize, E., Kaynig, V., Longair, M., Pietzsch, T., et al. (2012). Фиджи: платформа с открытым исходным кодом для анализа биологических изображений. Nat. Методы 9, 676–682. DOI: 10.1038 / nmeth.2019

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шапира Р., Леви Т., Шакед С., Фридман Э. и Дэвид Л. (2014). Обширный гетерозис в росте дрожжевых гибридов объясняется комбинацией генетических моделей. Наследственность 113, 316–326. DOI: 10.1038 / hdy.2014.33

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сигурдсон, Д. К., Гардер, М. Э., и Ливингстон, Д. М. (1981). Характеристика передачи во время образования цитодуктанта плазмиды ДНК размером 2 мкм из Saccharomyces . Мол. Genet Genet. 183, 59–65. DOI: 10.1007 / bf00270139

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сипицки, М. (2018). Межвидовая гибридизация и химеризация генома Saccharomyces : объединение генофондов видов и его биотехнологические перспективы. Фронт. Microbiol. 9: ​​3071. DOI: 10.3389 / fmicb.2018.03071

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Smukowski Heil, C. S., Desevo, C. G., Pai, D. A., Tucker, C. M., Hoang, M. L., and Dunham, M. J. (2017). Потеря гетерозиготности приводит к адаптации гибридных дрожжей. Мол. Биол. Evol. 34, 1596–1612. DOI: 10.1093 / molbev / msx098

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Стинселс, Дж., Меерсман, Э., Снук, Т., Саельс, В., Верстрепен, К. Дж. (2014a). Широкомасштабная селекция и селекция для получения промышленных дрожжей с превосходным ароматом. Заявл. Environ. Microbiol. 80, 6965–6975. DOI: 10.1128 / AEM.02235-14

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Стинселс, Дж., Снук, Т., Меерсман, Э., Николино, М. П., Вордекерс, К., Верстрепен, К. Дж. (2014b). Улучшение промышленных штаммов дрожжей: использование естественного и искусственного разнообразия. FEMS Microbiol. Ред. 38, 947–995. DOI: 10.1111 / 1574-6976.12073

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Стефанини И., Даппорто Л., Берна Л., Полсинелли М., Туриллацци С. и Кавальери Д. (2016). Социальные осы представляют собой гнездо для спаривания Saccharomyces . Proc. Natl. Акад. Sci. США 113, 2247–2251. DOI: 10.1073 / pnas.1516453113

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Трончони, Дж., Гамеро, А., Арройо-Лопес, Ф. Н., Баррио, Э., и Кероль, А. (2009). Различия в профилях потребления глюкозы и фруктозы у различных вин Saccharomyces и их гибридов при ферментации виноградного сока. Внутр. J. Food Microbiol. 134, 237–243. DOI: 10.1016 / j.ijfoodmicro.2009.07.004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Verduyn, C., Postma, E., Scheffers, W. A., and Van Dijken, J. P. (1992). Влияние бензойной кислоты на метаболические потоки в дрожжах: исследование в непрерывном культивировании на регуляцию дыхания и алкогольного брожения. Дрожжи 8, 501–517. DOI: 10.1002 / yea.320080703

PubMed Аннотация | CrossRef Полный текст | Google Scholar

(PDF) Ингибирование и роль let-7d в идиопатическом фиброзе легких

ИНГИБИРОВАНИЕ И РОЛЬ LET-7d при идиопатическом фиброзе легких

a, b, 1Kusum V. Pandit, b, 1David Corcoieranda, aHan cAgyris

Tzouvelekis, aKevin F. Gibson, aKazuhisa Konishi, dSamuel A. Yousem, aMandal Singh, a,

bDaniel Handley, aThomas Richards, eMoises Selman, gSimon C.Watkins, fAnnie Pardo, aAhmi

Ben-Yehudah, cDemosthenes Bouros, hOliver Eickelberg, aPrabir Ray, i, 2Panayiotis V. Benos,

a, 2Naftali Kaminski.

a Центр интерстициальной болезни легких Дороти П. и Ричарда П. Симмонса, отделение

Легочная медицина, аллергия и реанимация, Школа медицины Университета Питтсбурга,

Питтсбург, Пенсильвания. b Кафедра генетики человека, Высшая школа общественного здравоохранения, Университет

Питтсбурга, Питтсбург, Пенсильвания.c Кафедра пневмонологии, Медицинская школа, Демокрит

Университет Фракии и Университетская больница Александруполиса, 68100,

Александруполис / Греция. d Кафедра патологии, Университет Питтсбурга, Питтсбург, Пенсильвания.

eInstituto Nacional de Enfermedades Respiratorias, México DF, México.

fFacultad de Ciencias, Universidad Nacional Autónoma de México. gФакультет клеточной биологии

и физиологии, Школа медицины Университета Питтсбурга, Питтсбург, штат Пенсильвания, США

hКомплексный центр пневмологии, Мюнхен, Германия iДепартамент компьютерной биологии,

Школа медицины Университета Питтсбурга, PA

1 в равной степени

Переписка и запросы на перепечатку: Нафтали Камински, доктор медицины, Университет Питтсбурга

, Медицинский центр, NW 628 MUH, 3459 5-я авеню, Питтсбург, Пенсильвания 15261, Телефон: (412) 6473156,

Факс: (412) 6477875, Электронная почта: kaminskin @ upmc.edu, или Панайотис В. Бенос, электронная почта:

[email protected]

2Соответствующий автор

Страница 1 из 58Страница 1 из 58 Запрет на использование средств массовой информации до 2 недель после указанной выше даты публикации; см. thoracic.org/go/embargo

Статьи в прессе AJRCCM. Опубликовано 15 апреля 2010 г. как doi: 10.1164 / rccm.200911-1698OC

Авторские права (C) 2010 Американского торакального общества.

Let-7d подавляет рост, метастазирование и инфильтрацию опухолевыми макрофагами в почечно-клеточной карциноме, воздействуя на COL3A1 и CCL7 | Молекулярный рак

  • 1.

    Ramana J: RCDB: База данных генов рака почки. BMC Res Notes. 2012, 5: 246-10.1186 / 1756-0500-5-246

    PubMed Central CAS Статья PubMed Google Scholar

  • 2.

    Curti BD: Почечно-клеточная карцинома. ДЖАМА. 2004, 292: 97-100. 10.1001 / jama.292.1.97

    CAS Статья PubMed Google Scholar

  • 3.

    Vogelzang NJ, Stadler WM: Рак почки.Ланцет. 1998, 352: 1691-1696. 10.1016 / S0140-6736 (98) 01041-1

    CAS Статья PubMed Google Scholar

  • 4.

    Рини Б.И., Кэмпбелл С.К., Эскудье Б. Почечно-клеточная карцинома. Ланцет. 2009, 373: 1119-1132. 10.1016 / S0140-6736 (09) 60229-4

    CAS Статья PubMed Google Scholar

  • 5.

    Motzer RJ, Russo P, Nanus DM, Berg WJ: Почечно-клеточная карцинома. Curr Probl Cancer.1997, 21: 185-232. 10.1016 / S0147-0272 (97) 80007-4

    CAS Статья PubMed Google Scholar

  • 6.

    Flanigan RC, Salmon SE, Blumenstein BA, Bearman SI, Roy V, McGrath PC, Caton JJ, Munshi N, Crawford ED: нефрэктомия с последующим введением интерферона альфа-2b по сравнению с одним только интерфероном альфа-2b при метастазах в почках -клеточный рак. N Engl J Med. 2001, 345: 1655-1659. 10.1056 / NEJMoa003013

    CAS Статья PubMed Google Scholar

  • 7.

    Croce CM, Calin GA: миРНК, рак и деление стволовых клеток. Клетка. 2005, 122: 6-7. 10.1016 / j.cell.2005.06.036

    CAS Статья PubMed Google Scholar

  • 8.

    Cui SY, Huang JY, Chen YT, Song HZ, Feng B, Huang GC, Wang R, Chen LB, De W: Let-7c управляет приобретением химио- или радиорезистентности и эпителиально-мезенхимальной устойчивости переходные фенотипы при аденокарциноме легкого, устойчивой к доцетакселу. Mol Cancer Res. 2013, 11: 699-713.10.1158 / 1541-7786.MCR-13-0019-T

    CAS Статья PubMed Google Scholar

  • 9.

    Джойс Дж., Поллард Дж. У.: Регуляция метастазов в микросреде. Нат Рев Рак. 2009, 9: 239-252. 10.1038 / nrc2618

    PubMed Central CAS Статья PubMed Google Scholar

  • 10.

    Ханахан Д., Вайнберг Р.А.: Признаки рака: следующее поколение. Клетка.2011, 144: 646-674. 10.1016 / j.cell.2011.02.013

    CAS Статья PubMed Google Scholar

  • 11.

    Сун П., Киарис Х: МикроРНК в микросреде опухоли: большая роль для мелких игроков. Endocr Relat Cancer. 2013, 20: R257-R267. 10.1530 / ERC-13-0119

    CAS Статья PubMed Google Scholar

  • 12.

    Boyerinas B, Park SM, Hau A, Murmann AE, Peter ME: Роль let-7 в дифференцировке клеток и раке.Endocr Relat Cancer. 2010, 17: F19-F36. 10.1677 / ERC-09-0184

    CAS Статья PubMed Google Scholar

  • 13.

    Bussing I, Slack FJ, Grosshans H: микроРНК let-7 в развитии, стволовые клетки и рак. Тенденции Мол Мед. 2008, 14: 400-409. 10.1016 / j.molmed.2008.07.001

    Артикул PubMed Google Scholar

  • 14.

    Thomson JM, Parker J, Perou CM, Hammond SM: пользовательская платформа микрочипов для анализа экспрессии генов микроРНК.Нат методы. 2004, 1: 47-53. 10.1038 / nmeth704

    CAS Статья PubMed Google Scholar

  • 15.

    Симидзу С., Такехара Т, Хикита Х, Кодама Т, Мияги Т, Хосуи А, Тацуми Т, Исида Х, Нода Т, Нагано Х, Доки Й, Мори М., Хаяси Н.: Семья лет-7 микроРНК подавляет экспрессию Bcl-xL и усиливает апоптоз, вызванный сорафенибом, в гепатоцеллюлярной карциноме человека. J Hepatol. 2010, 52: 698-704. 10.1016 / j.jhep.2009.12.024

    CAS Статья PubMed Google Scholar

  • 16.

    Чжао Б., Хань Х, Чен Дж, Чжан З., Ли С., Фанг Ф, Чжэн К., Ма И, Чжан Дж, Ву Н, Ян Y: МикроРНК let-7c ингибирует миграцию и инвазию немелкоклеточного рака легкого человека за счет ориентации на ITGB3 и MAP4K3. Cancer Lett. 2014, 342: 43-51. 10.1016 / j.canlet.2013.08.030

    CAS Статья PubMed Google Scholar

  • 17.

    Yu F, Yao H, Zhu P, Zhang X, Pan Q, Gong C, Huang Y, Hu X, Su F, Lieberman J, Song E: let-7 регулирует самообновление и онкогенность рака груди клетки.Клетка. 2007, 131: 1109-1123. 10.1016 / j.cell.2007.10.054

    CAS Статья PubMed Google Scholar

  • 18.

    Shell S, Park SM, Radjabi AR, Schickel R, Kistner EO, ​​Jewell DA, Feig C, Lengyel E, Peter ME: экспрессия Let-7 определяет две стадии дифференцировки рака. Proc Natl Acad Sci U S. A. 2007, 104: 11400-11405. 10.1073 / pnas.0704372104

    PubMed Central CAS Статья PubMed Google Scholar

  • 19.

    Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D, Slack FJ: RAS регулируется семейством микроРНК let-7. Клетка. 2005, 120: 635-647. 10.1016 / j.cell.2005.01.014

    CAS Статья PubMed Google Scholar

  • 20.

    Лю Ю., Инь Б., Чжан С., Чжоу Л., Фань Дж.: Hsa-let-7a действует как опухолевый супрессор в клеточных линиях почечно-клеточной карциномы, воздействуя на c-myc. Biochem Biophys Res Commun.2012, 417: 371-375. 10.1016 / j.bbrc.2011.11.119

    CAS Статья PubMed Google Scholar

  • 21.

    Tuna B, Yorukoglu K, Unlu M, Mungan MU, Kirkali Z: Ассоциация тучных клеток с плотностью микрососудов в почечно-клеточном раке. Eur Urol. 2006, 50: 530-534. 10.1016 / j.eururo.2005.12.040

    Артикул PubMed Google Scholar

  • 22.

    Liotta F, Gacci M, Frosali F, Querci V, Vittori G, Lapini A, Santarlasci V, Serni S, Cosmi L, Maggi L, Angeli R, Mazzinghi B, Romagnani P, Maggi E, Carini M , Romagnani S, Annunziato F: Частота регуляторных Т-клеток в периферической крови и лимфоцитах, инфильтрирующих опухоль, коррелирует с плохим прогнозом при почечно-клеточной карциноме.BJU Int. 2011, 107: 1500-1506. 10.1111 / j.1464-410X.2010.09555.x

    CAS Статья PubMed Google Scholar

  • 23.

    Hou J, Lin L, Zhou W, Wang Z, Ding G, Dong Q, Qin L, Wu X, Zheng Y, Yang Y, Tian W, Zhang Q, Wang C, Zhang Q, Zhuang SM , Zheng L, Liang A, Tao W, Cao X: Идентификация miRNomes в печени и гепатоцеллюлярной карциноме человека показывает miR-199a / b-3p в качестве терапевтической мишени для гепатоцеллюлярной карциномы. Раковая клетка.2011, 19: 232-243. 10.1016 / j.ccr.2011.01.001

    CAS Статья PubMed Google Scholar

  • 24.

    Омнибусная база данных экспрессии генов. [http://www.ncbi.nlm.nih.gov/geoprofiles/]

  • 25.

    Руш С., Slack FJ: Семейство микроРНК let-7. Trends Cell Biol. 2008, 18: 505-516. 10.1016 / j.tcb.2008.07.007

    CAS Статья PubMed Google Scholar

  • 26.

    Provenzano PP, Eliceiri KW, Campbell JM, Inman DR, White JG, Keely PJ: Реорганизация коллагена на границе опухоли и стромы облегчает локальную инвазию. BMC Med. 2006, 4: 38-10. 1186 / 1741-7015-4-38

    PubMed Central Статья PubMed Google Scholar

  • 27.

    Ng MR, Brugge JS: Жесткий удар со стороны стромы: сшивание коллагена приводит к прогрессированию опухоли. Раковая клетка. 2009, 16: 455-457. 10.1016 / j.ccr.2009.11.013

    CAS Статья PubMed Google Scholar

  • 28.

    Provenzano PP, Inman DR, Eliceiri KW, Keely PJ: Механорегуляция, индуцированная плотностью матрицы, фенотипа клеток груди, передачи сигналов и экспрессии генов через связь FAK-ERK. Онкоген. 2009, 28: 4326-4343. 10.1038 / onc.2009.299

    PubMed Central CAS Статья PubMed Google Scholar

  • 29.

    Сантала М., Симойоки М., Ристели Дж., Ристели Л., Кауппила А. Метаболиты коллагена типа I и III как предикторы клинического исхода эпителиального рака яичников.Clin Cancer Res. 1999, 5: 4091-4096.

    CAS PubMed Google Scholar

  • 30.

    Maurer B, Stanczyk J, Jungel A, Akhmetshina A, Trenkmann M, Brock M, Kowal-Bielecka O, Gay RE, Michel BA, Distler JH, Gay S, Distler O: MicroRNA-29, ключ регулятор экспрессии коллагена при системном склерозе. Rheum артрита. 2010, 62: 1733-1743.

    CAS Статья PubMed Google Scholar

  • 31.

    Rothschild SI, Tschan MP, Federzoni EA, Jaggi R, Fey MF, Gugger M, Gautschi O: MicroRNA-29b участвует в сигнальном пути Src-ID1 и не регулируется в аденокарциноме легких человека. Онкоген. 2012, 31: 4221-4232. 10.1038 / onc.2011.578

    CAS Статья PubMed Google Scholar

  • 32.

    Qian BZ, Pollard JW: Разнообразие макрофагов увеличивает прогрессирование опухоли и метастазирование. Клетка. 2010, 141: 39-51. 10.1016 / j.cell.2010.03.014

    CAS Статья PubMed Google Scholar

  • 33.

    Santoni M, Massari F, Amantini C, Nabissi M, Maines F, Burattini L, Berardi R, Santoni G, Montironi R, Tortora G, Cascinu S. пациенты с метастатическим почечно-клеточным раком. Cancer Immunol Immunother. 2013, 62: 1757-1768. 10.1007 / s00262-013-1487-6

    CAS Статья PubMed Google Scholar

  • 34.

    Hwang TL, Lee LY, Wang CC, Liang Y, Huang SF, Wu CM: сверхэкспрессия CCL7 и CCL21 при раке желудка связана с метастазами в лимфатические узлы и плохим прогнозом. Мир Дж. Гастроэнтерол. 2012, 18: 1249-1256. 10.3748 / wjg.v18.i11.1249

    PubMed Central CAS Статья PubMed Google Scholar

  • 35.

    Okada M, Saio M, Kito Y, Ohe N, Yano H, Yoshimura S, Iwama T, Takami T: инфильтрация макрофагов / микроглии, связанных с опухолью, в глиомах человека коррелирует с MCP-3, но не с MCP -1.Int J Oncol. 2009, 34: 1621-1627.

    CAS PubMed Google Scholar

  • 36.

    Wyler L, Napoli CU, Ingold B, Sulser T., Heikenwalder M, Schraml P, Moch H: Метастазы в мозг у пациентов с раком почек: метастатический паттерн, опухолевые макрофаги и экспрессия хемокинов / хеморецепторов. Br J Рак. 2014, 110: 686-694. 10.1038 / bjc.2013.755

    PubMed Central CAS Статья PubMed Google Scholar

  • 37.

    Qian BZ, Li J, Zhang H, Kitamura T, Zhang J, Campion LR, Kaiser EA, Snyder LA, Pollard JW: CCL2 привлекает воспалительные моноциты для облегчения метастазирования опухоли молочной железы. Природа. 2011, 475: 222-225. 10.1038 / nature10138

    PubMed Central CAS Статья PubMed Google Scholar

  • 38.

    Hemmerlein B, Johanns U, Kugler A, Reffelmann M, Radzun HJ: Количественная оценка и локализация in situ мРНК MCP-1 и ее связь с иммунным ответом почечно-клеточного рака.Цитокин. 2001, 13: 227-233. 10.1006 / cyto.2000.0823

    CAS Статья PubMed Google Scholar

  • 39.

    Юнг Д.В., Че З.М., Ким Дж., Ким К., Ким К.Й., Уильямс Д., Ким Дж .: Взаимодействие между опухолью и стромой при инвазии плоскоклеточного рака полости рта: центральная роль CCL7. Int J Cancer. 2010, 127: 332-344.

    CAS PubMed Google Scholar

  • 40.

    Ковач Г., Ахтар М., Беквит Б.Дж., Бугерт П., Купер С.С., Делахант Б., Эбл Д.Н., Флеминг С., Юнгберг Б., Медейрос Л.Дж., Мох Х, Рейтер В.Е., Ритц Э, Роос Дж., Шмидт Д. , Srigley JR, Störkel S, van den Berg E, Zbar B: Гейдельбергская классификация почечно-клеточных опухолей.J Pathol. 1997, 183: 131-133. 10.1002 / (SICI) 1096-9896 (199710) 183: 2 <131 :: AID-PATH931> 3.0.CO; 2-G

    CAS Статья PubMed Google Scholar

  • 41.

    Pichler M, Hutterer GC, Chromecki TF, Jesche J, Kampel-Kettner K, Groselj-Strele A, Hoefler G, Pummer K, Zigeuner R: Сравнение систем классификации 2002 и TNM в отношении предсказания исхода в ясной форме клеточная и папиллярная почечно-клеточная карцинома. Гистопатология. 2010, 2013 (62): 237-246.

    Google Scholar

  • 42.

    Fuhrman SA, Lasky LC, Limas C: Прогностическое значение морфологических параметров почечно-клеточного рака. Am J Surg Pathol. 1982, 6: 655-663. 10.1097 / 00000478-198210000-00007

    CAS Статья PubMed Google Scholar

  • 43.

    Sica A, Saccani A, Bottazzi B, Bernasconi S, Allavena P, Gaetano B, Fei F, LaRosa G, Scotton C, Balkwill F, Mantovani A: Нарушение экспрессии рецептора хемотаксического белка-1 моноцитов CCR2 в макрофагах, связанных с карциномой яичников человека.J Immunol. 2000, 164: 733-738. 10.4049 / jimmunol.164.2.733

    CAS Статья PubMed Google Scholar

  • 44.

    Varkonyi-Gasic E, Hellens RP: Количественная ОТ-ПЦР «стебель-петля» для обнаружения микроРНК. Методы Мол биол. 2011, 744: 145-157. 10.1007 / 978-1-61779-123-9_10

    CAS Статья PubMed Google Scholar

  • 45.

    Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, Lao KQ, Livak KJ, Guegler KJ: количественная оценка в реальном времени микроРНК методом ОТ-ПЦР «стебель-петля».Nucleic Acids Res. 2005, 33: e179-10.1093 / nar / gni178

    PubMed Central Статья PubMed Google Scholar

  • 46.

    Lan L, Han H, Zuo H, Chen Z, Du Y, Zhao W, Gu J, Zhang Z: Повышенная регуляция миозина Va улиткой участвует в миграции раковых клеток и метастазировании. Int J Cancer. 2010, 126: 53-64. 10.1002 / ijc.24641

    CAS Статья PubMed Google Scholar

  • 47.

    Zijlstra A, Mellor R, Panzarella G, Aimes RT, Hooper JD, Marchenko ND, Quigley JP: количественный анализ стадий, ограничивающих скорость в метастатическом каскаде, с использованием специфической для человека полимеразной цепной реакции в реальном времени. Cancer Res. 2002, 62: 7083-7092.

    CAS PubMed Google Scholar

  • 48.

    Lee RH, Pulin AA, Seo MJ, Kota DJ, Ylostalo J, Larson BL, Semprun-Prieto L, Delafontaine P, Prockop DJ: внутривенные hMSC улучшают инфаркт миокарда у мышей, потому что клетки, эмболизированные в легких, активируются до секретируют противовоспалительный белок TSG-6.Стволовая клетка клетки. 2009, 5: 54-63. 10.1016 / j.stem.2009.05.003

    PubMed Central CAS Статья PubMed Google Scholar

  • 49.

    He L, Ding H, Wang JH, Zhou Y, Li L, Yu YH, Huang L, Jia WH, Zeng M, Yun JP, Luo RZ, Zheng M: сверхэкспрессия кариоферина 2 в злокачественных опухолях яичников человека опухоль зародышевых клеток коррелирует с плохим прогнозом. PLoS One. 2012, 7: e42992-10.1371 / journal.pone.0042992

    PubMed Central CAS Статья PubMed Google Scholar

  • 50.

    Yao Q, Cao S, Li C, Mengesha A, Kong B, Wei M: Микро-РНК-21 регулирует индуцированную TGF-бета дифференцировку миофибробластов путем нацеливания на PDCD4 при взаимодействии опухоль-строма. Int J Cancer. 2011, 128: 1783-1792. 10.1002 / ijc.25506

    CAS Статья PubMed Google Scholar

  • IJMS | Бесплатный полнотекстовый | МикроРНК Let-7d-3p способствует защите сердца посредством нацеливания на HMGA2

    1. Введение

    Циркулирующие микроРНК (миРНК) были впервые обнаружены в плазме человека десять лет назад.С тех пор они широко измерялись как в сыворотке, так и в плазме как многообещающие биомаркеры различных заболеваний. Открытие терапевтических мишеней miRNA с помощью дисрегулируемых miRNA в плазме, наблюдаемых в клинических когортах, было продуктивной стратегией. Хорошо изученные miRNA при сердечно-сосудистых заболеваниях включают miR-208a, miR-208b и miR-499, которые известны как потенциальные биомаркеры острого инфаркта миокарда [1,2]. Антимир miR-208a значительно подавлял гипертрофию миокарда и периваскулярный фиброз у крыс, получавших высокосолевую диету [3], а miR-499 снижал апоптоз во время ишемии / реперфузии [4].Семейство miR-208 продемонстрировало свой потенциал в обеспечении как биомаркеров, так и терапевтических мишеней. Мы стремились изучить терапевтический потенциал miRNAs, идентифицированных в ходе клинических исследований. Недавно мы сообщили о возможности использования miRNA в качестве биомаркеров у 1710 контрольных пациентов без сердечной недостаточности и пациентов с сердечной недостаточностью [5]. Мы проверили ~ 200 циркулирующих miRNA и идентифицировали набор miRNA с нарушенной регуляцией у пациентов с сердечной недостаточностью. На основании более высокого кратного изменения и большей площади под кривой (AUC), а также гомологов последовательностей miRNA между человеком и крысой, пять из этих дисрегулируемых miRNA были отобраны для функционального исследования на модели гипоксии ex vivo.Let-7d-3p, miR-503-5p и miR-134-5p были значительно повышены, а miR-374b-5p и miR-30b-5p были значительно подавлены (p5). Повышенная регуляция miR-503 способствует сердечному фиброзу. у мышей с поперечным сужением аорты (TAC) и сердечных фибробластов, получавших лечение Angiotension II [6]. Уровень MiR-134 значительно выше у пациентов с острым инфарктом миокарда, и это увеличение тесно связано со смертностью или развитием сердечной недостаточности [7]. Подавление транскрипция miR-30b с помощью E2F1 ингибировала некроз кардиомиоцитов и уменьшала размер инфаркта миокарда при ишемии / реперфузионном повреждении [8].Сверхэкспрессия Let-7d (5p) ослабляет отложение коллагена, препятствует сердечному фиброзу и улучшает сердечную функцию у мышей с инфарктом миокарда посредством регулирования рецептора фактора активации тромбоцитов (Ptafr) [9]. Таким образом, эти результаты показали, что было целесообразно изучить возможную терапевтическую роль этих выбранных miRNA в ишемическом повреждении. Lethal-7 или Let-7 были одной из первых двух известных miRNA, обнаруженных у Caenorhabditis elegans [10], и первой известной человеческой miRNA. [11]. Семейство Let-7 состоит из 13 членов, которые высоко консервативны у разных видов [12].Они имеют одну и ту же посевную последовательность и нацелены на множественные генные мишени в различных типах клеток. Известно, что многие генные мишени семейства Let-7 играют роль в ишемической болезни сердца, включая TLR4, lox-1, Bcl-xl и AGO1 [13]. Ингибирование Let-7c улучшает сердечную функцию после инфаркта миокарда за счет уменьшения сердечного фиброза и апоптоза [14]. Восстановление Let-7g защищает кардиомиоциты от апоптоза посредством нацеливания на Pik3ip1, ингибитор сигнального пути выживания Akt во время острого реперфузионного повреждения ишемией [15].Трансфекция имитатора Let-7d (5p) в бляшку сонной артерии человека ex vivo оказывает противовоспалительное действие при диабете, связанном с атеросклерозом [16]. Let-7d-3p (предыдущий идентификатор: Let-3d *) - это пассажирская ветка, которая раньше считалась «нефункциональной». Таким образом, мало что известно о Let-7d-3p, и нет исследований в условиях ишемии или на модели сердечной клеточной линии. Острый инфаркт миокарда, основная причина сердечной недостаточности, является ведущей причиной смертности во всем мире. Кардиомиоциты не обладают регенеративной способностью, поэтому защита сердца от ишемического повреждения имеет решающее значение для спасения ишемического миокарда.Апоптоз и аутофагия - это два разных процесса, которые активируются одновременно при ишемии и / или ишемической реперфузии. Они играют ключевую роль в опосредовании гибели кардиомиоцитов. Апоптоз или запрограммированная гибель клеток запускается во время и после инфаркта миокарда и способствует гибели клеток кардиомицитов [17]. Уровень апоптоза может влиять на размер инфаркта и степень неблагоприятного ремоделирования левого желудочка, потенциально приводя к сердечной недостаточности после острого инфаркта миокарда [18]. Аутофагия активируется лишением питательных веществ и энергии из-за ишемии.Он может быть защитным путем удаления поврежденных митохондрий [19], восстановления продукции АТФ [20] и / или удаления агрегатов токсичных белков [21]. Однако чрезмерная аутофагия, вызванная ишемией, пагубна [22,23]. Было подтверждено, что ингибирование ишемического апоптоза и аутофагии в сердце является защитным [24,25,26]. Таким образом, в этом исследовании мы исследовали эффекты Let-7d-3p на апоптоз и аутофагию, а также лежащие в основе механизмы. Гены Mex3C, KLF9, KLF12, HMGA2 и YY1 представляют собой in silico предсказанные Let-7d-3p мишени, связанные с выживаемостью клеток, апоптозом и сердечными функциями.В частности, HMGA2, член группы A с высокой подвижностью (HMG), играет жизненно важную роль в кардиогенезе [27]. Сверхэкспрессия HMGA2 индуцировала апоптоз за счет активации расщепленной каспазы 3 через путь повреждения ДНК [28]. Однако роль HMGA2 в защите сердца посредством апоптоза и аутофагии еще предстоит определить.

    Используя подход функционального скрининга дисрегулируемых циркулирующих miRNAs, идентифицированных у пациентов с сердечной недостаточностью, мы обнаружили потенциальные терапевтические мишени miRNA для кардиопротекции.Используя модель гипоксии ex vivo H9c2 и NRVM против гипоксии, мы продемонстрировали, что Let-7d-3p является многообещающей терапевтической мишенью miRNA при ишемии сердца.

    3. Обсуждение

    Наши данные показывают, что Let-7d-3p оказывает защитное действие как на клетки H9c2, так и на клетки NRVM, подвергшиеся гипоксии. Защитные эффекты обусловлены подавлением апоптоза. Направление HMGA2 через прямое связывание 3’-UTR может быть механизмом этого ингибирования. Наши текущие открытия дают представление об улучшении травмы, вызванной гипоксией, с помощью Let-7d-3p и идентифицируют Let-7d-3p как потенциальную терапевтическую мишень при сердечной ишемии и сердечной недостаточности.

    Уровень Let-7d-3p сильно повышен в когортах пациентов с сердечной недостаточностью по сравнению с контрольной группой без сердечной недостаточности [5]. Повышающая регуляция Let-7d-3p с помощью имитирующей трансфекции защищала H9c2 и NRVM от повреждения гипоксией. Напротив, подавление Let-7d-3p не имело эффекта. По совпадению, обращение вспять уменьшения miR-374b-5p и miR-30b-5p с помощью миметиков не дало положительных эффектов. Одной из проблем при разработке терапевтических средств, опосредованных miRNA, для лечения сердечно-сосудистых заболеваний является идентификация таких мишеней miRNA.Противодействие значительному нарушению регуляции miRNAs - это хорошо используемая уловка. Например, перегрузка давлением снижает уровень miR-101a, который активирует передачу сигналов TGF-β в сердце. Обратное уменьшение эндогенного miR-101a с помощью миметика оказывает благоприятное антифиброзное действие [31]. Однако нарушение регуляции miRNA не всегда может быть вредным для болезненного состояния. Это могло быть компенсационное изменение. Напр. MiR-221 повышен у пациентов с сердечной недостаточностью [5], а активация miR-221 оказывает защитный эффект при повреждении гипоксией-реоксигенацией посредством нацеливания на Ddit4 и Tp53inp1 [25].Выполняя функциональный скрининг набора дисрегулируемых циркулирующих miRNA у пациентов с сердечной недостаточностью, мы впоследствии обнаружили сверхэкспрессию Let-7d-3p, защищенного H9c2 и NRVM против ишемического повреждения. Индуцированные ишемией апоптоз и аутофагия играют важную роль в ишемическом повреждении. При двойном окрашивании 7-AAD и анексином V Let-7d-3p ингибировал ранний и поздний апоптоз, что позволяет предположить, что Let-7d-3p может способствовать выживанию клеток. До сих пор не было такого отчета, показывающего защитный эффект Let-7d-3p в этом контексте, и он даже не охарактеризован при каких-либо сердечно-сосудистых заболеваниях.При раке яичников ингибирование Let-7d-3p с помощью антагомиров показало значительное снижение клеточной пролиферации и активировало апоптоз в клетках рака яичников [32]. Эти результаты согласуются с нашим выводом о том, что Let-7d-3p имитирует повышенную жизнеспособность клеток и снижает апоптоз. Аутофагию оценивали с помощью отношения LC3 II / I, а поток аутофагии оценивали с помощью обработки Baf, которая блокирует слияние аутофагосома-лизосома. Увеличение LC3 II / I указывает на усиление образования аутофагосом.Let-7d-3p не вызывал никаких изменений LC3 II или соотношения LC3 II / I с Baf или без него. Таким образом, Let-7d-3p не влияет на аутофагию в этом контексте. Мы дополнительно исследовали механизмы, лежащие в основе Let-7d-3p. Используя стандартные подходы к прогнозированию и проверке мишеней miRNA, были исследованы пять соответствующих генов-мишеней; Было подтверждено, что три из них, HMGA2, YY1 и Mex3c, имеют прямое взаимодействие с Let-7d-3p. Среди них HMGA2 и YY1 были подавлены на уровне мРНК и / или белка, но Mex3c не был значительно подавлен на уровне белка в обоих типах клеток.Mex3c, РНК-связывающий белок, играет роль в постнатальном росте [33] и регулирует энергетический баланс [34]. Он не имеет известного влияния на сердечную защиту. Экспрессия белка YY1 не изменялась при гипоксии, но значительно снижалась Let-7d-3p в H9c2. В отличие от H9c2, уровень белка YY1 полностью подавлялся в NRVM в условиях гипоксии, и, таким образом, миметик Let-7d-3p не мог вызывать дальнейшее подавление. YY1 является транскрипционным фактором и играет ключевую роль в раннем развитии сердца [35]. Его экспрессия была повышена при сердечной недостаточности человека и вызывала патологическую гипертрофию [36].Роль YY1 в ишемии противоречива. Это важный р53-негативный регулятор, поэтому инактивация YY1 заставляет клетки повышать чувствительность к апоптозу, вызванному повреждением ДНК [37,38]. С другой стороны, ингибирование YY1 снижает накопление индуцируемого гипоксией фактора 1α (HIF1α) независимо от р53 [39]. Наши данные показали, что экспрессия его белка не изменилась в H9c2, но значительно снизилась в NRVM из-за ишемии. Причина этой специфической реакции клеточного типа неясна. В совокупности мы подозреваем, что регулирование YY1 может не играть роли в этой ситуации.Экспрессия белка HMGA2 значительно повышалась при гипоксии, и Let-7d-3p подавлял это изменение как в H9c2, так и в NRVM. Эти данные делают его многообещающей мишенью для защитных эффектов, вызванных Let-7d-3p. HMGA2 широко известен как онкобелок в биологии рака [40]. Существуют убедительные доказательства того, что HMGA2 является важным триггером апоптоза в исследованиях рака. Повреждение двухцепочечной ДНК зависит от процесса репарации негомологичного соединения концов (NHEJ) [41]. HMGA2 блокирует эту репарацию за счет ингибирования ДНК-зависимой протеинкиназы (ДНК-PK) [42].Следовательно, увеличение HMGA2 приведет к накоплению клеток с повреждением ДНК. Это было дополнительно подтверждено исследованием, показывающим, что сверхэкспрессия HMGA2 может инициализировать активацию каспазы-2 и дополнительно индуцировать высвобождение каспазы-3, расположенного ниже по течению, маркера митохондриально-опосредованного апоптоза [28]. Они также продемонстрировали, что индуцированный HMGA2 апоптоз коррелирует с повышающей регуляцией расщепленной каспазы 3, предполагая, что индуцированный HMGA2 апоптоз зависит от пути повреждения ДНК. Известно, что повреждение ДНК, вызванное ишемией, является триггером ишемического апоптоза [17].Следовательно, разумно предположить, что активация HMGA2 блокирует репарацию поврежденной ДНК при ишемии, что, в свою очередь, вызывает апоптоз. Подавление HMGA2 с помощью Let-7d-3p является полезным. Дальнейшие данные подтверждают, что проапоптотические эффекты HMGA2 вызваны повышающей регуляцией p53, Bax, расщепленной каспазой 9 и понижающей регуляцией антиапоптотического гена Bcl-2 и Apaf1 [28]. Одна ранняя работа показала, что Let-7a подавляет экспрессию HMGA2 в раковых клетках [43]. Поскольку семейство Let-7 имеет одну и ту же последовательность зародышевой области, это подтверждает наш вывод.Взятые вместе, посредством прямого нацеливания на HMGA2, Let-7d-3p ингибировал апоптоз и защищал клетки от повреждения ишемией.

    Апоптоз оценивали только в H9c2, поскольку NRVM чувствительны к расщеплению трипсином, что не подходит для анализа аннексина V / 7-AAD на основе потока. За исключением этого, все эксперименты проводились параллельно в H9c2 и NRVM. Результаты очень стабильны. Таким образом, скрининг предварительно отобранного набора miRNAs из нашего предыдущего клинического исследования, мы обнаружили, что увеличение экспрессии Let-7d-3p снижает повреждение клеток и апоптоз.Используя подходы анализа репортера люциферазы, RT-qPCR и вестерн-блоттинга, мы продемонстрировали, что HMGA2 является прямой мишенью Let-7d-3p. Опираясь на опубликованные результаты, мы предположили, что антиапоптотический эффект Let-7d-3p при гипоксии обусловлен подавлением HMGA2.

    4. Материалы и методы

    4.1. H9c2, выделение и культивирование NRVM
    Клетки H9c2, клеточную линию кардиомиобластов крыс выращивали в среде Игла, модифицированной Дульбекко (DMEM), содержащей 10% фетальной бычьей сыворотки (FBS) и 1% пенициллин-стрептомицина при 37 ° C в атмосфере 95 ° C. % воздуха и 5% CO 2 .NRVM выделяли от неонатальных крыс в возрасте 1-3 дней путем ферментативного переваривания и механической диссоциации, как описано ранее [25]. Очищенные кардиомиоциты высевали в покрытые коллагеном чашки с M199 и DMEM 1: 4, содержащими 15% FBS и 1% антимикотических антибиотиков. После прикрепления в течение ночи культуральную среду заменяли 1: 4 M199 и DMEM, содержащей 10% FBS, 50 мкМ цитозинарабинозид-C и 1% антимикотических антибиотиков, и поддерживали во всех культурах.
    4.2. Трансфекция miRNA
    миметиков miRNA (miRVana, Ambion, Singapore) трансфицировали в H9c2 и NRVM в соответствии с инструкциями производителя.Вкратце, конечную концентрацию 25 нМ миметиков miRNA и липофектамин RNAiMAX (Invitrogen, Сингапур) инкубировали при соотношении 20 пмоль: 1 мкл. Мимический контроль (MC), ингибитор Let-7d-3p и контроль ингибитора (IC) трансфицировали в одинаковых условиях [29].
    4.3. Протокол гипоксии
    Через 24 часа трансфекции H9c2 подвергали 15-часовой гипоксии (0,2% кислорода) бессывороточной DMEM, содержащей 1% глутамакса и 1% пенициллин-стрептомицин. NRVM подвергали 6-часовой гипоксии (0.2% кислорода) в модифицированном буфере Эсуми (137 нМ NaCl, 12 мМ KCl, 0,5 мМ MgCl2, 0,9 мМ CaCl2, 4 мМ натриевая соль гидроксиэтилпиперазинэтансульфоновой кислоты (HEPES), 20 мМ лактат натрия, 10 мМ 2-дезоксиглюкса, pH 6,2) . В группе с нормоксией клетки культивировали в культуральной среде при нормальных условиях [25,29].
    4.4. Оценка повреждения и жизнеспособности клеток

    После лечения гипоксией высвобождение лактатдегидрогеназы (ЛДГ) измеряли с помощью набора для определения цитотоксичности (TOX7, Sigma-Aldrich Corp., Сингапур) согласно инструкции производителя. Оптическую плотность образцов измеряли при 490 нм (многомодовый планшетный ридер EnSpire, Perkin Elmer, Уолтем, Массачусетс, США). Жизнеспособность клеток CCK8 (Sigma-Aldrich Corp., Сингапур) измеряли в соответствии с инструкциями производителя. Поглощение образцов измеряли при 460 нм.

    4.5. Оценка апоптоза и аутофагии

    H9c2 были обработаны трипсином для оценки апоптоза с использованием двойного окрашивания аннексином V и 7-AAD (анализатор клеток MUSE, Merck Millipore Corp, Сингапур) в соответствии с инструкциями производителя.Для анализа аутофагии клетки обрабатывали либо ДМСО, либо 10 нМ Baf A1 в течение 2 часов после гипоксии. Клетки лизировали для вестерн-блоттинга против LC-3 I и II (SC-376404, Santa Cruz Biotechnology, Axil Scientific, Сингапур). β-актин (SC-47778, Santa Cruz) использовали в качестве контроля загрузки.

    4.6. Анализ люциферазы

    3'UTR целевых генов были направленно клонированы в векторы psiCHECK-2 (Promega, Corp., Сингапур). Плазмиду и имитаторы Let-7d-3p котрансфицировали в клетки Hela.Активность люциферазы в клеточном лизате определяли с использованием системы двойного люциферазного репортерного анализа (система анализа DLR, Promega Corp., Сингапур) в соответствии с протоколом производителя. Сенсор Let-7d-3p (Let-7dS), комплементарную связывающую последовательность Let-7d-3p, использовали в качестве положительного контроля.

    4.7. Количественный анализ ПЦР в реальном времени (RT-qPCR)

    Всего РНК из H9c2 и NRVM экстрагировали реагентом Trizol (Invitrogen, Singapore) в соответствии с протоколом производителя.Праймерами (Integrated DNA Technologies, Сингапур), использованными для обнаружения экспрессии мРНК, были HMGA2 (Rn.PT.58.44563776), YY1 (Rn.PT.58.7943099), MEX3C (Rn.PT.58.9714240) и эндогенный контроль RPLP0 (Rn.PT .58.32850825). Экспрессию генов измеряли с помощью универсальной обратной транскрипции и RT-qPCR (система ПЦР в реальном времени Quant Studio ™ 7 Flex, Applied Biosystems, Сингапур) и количественно оценивали с использованием метода 2 -∆∆Ct .

    4.8. Вестерн-блот

    Равное количество образца денатурированного белка было разделено 10% SDS-полиакриламидным гелем, перенесено на PVDF-мембраны и исследовано антителами против YY1, HMGA2, Mex3C и β-актина (SC-7341, SC-30223, SC -398440, SC-47778, Санта-Крус).После инкубации с вторичным антителом, конъюгированным с пероксидазой (BioRad, Сингапур) и субстратом для блоттинга ECL (BioRad, Сингапур), интересующий белок визуализировали с помощью гель-док-системы G: Box (Chemi XT4, Syngene, Фредерик, Мэриленд, США).

    4.9. Статистика

    Все данные выражены как среднее ± стандартное отклонение. Для сравнения разницы между контрольной и обработанной группами был проведен t-критерий Стьюдента. p <0,05 использовалось в качестве критерия статистической значимости.

    BEAR CREEK LUMBER: ОБЩАЯ ИНФОРМАЦИЯ: ГВОЗДИ

    Используйте горячеоцинкованную, алюминиевую или нержавеющую сталь

    Гвозди из горячеоцинкованной, алюминиевой и нержавеющей стали устойчивы к коррозии, и все они могут использоваться для гвоздей западного красного кедра.Другие типы ногтей не рекомендуются. Они могут ржаветь, разлагаться и плохо реагировать с натуральными консервирующими маслами, присутствующими в кедре, что приводит к образованию пятен и полос. Медные гвозди также вступают в реакцию с кедром, поэтому их нельзя использовать.
    Гвозди из нержавеющей стали - лучший выбор, особенно если сайдинг будет отделан прозрачной морилкой. Используйте нержавеющую сталь № 304 для общих применений сайдинга и № 316 для воздействия на морское побережье.

    Гвозди: тип, размер и расстояние

    Для достижения наилучших результатов используйте гвозди для сайдинга без раскола.У них тонкие стержни и тупые концы для уменьшения раскалывания. Для большей удерживающей способности предлагаются гвозди с хвостовиком с кольцевой или спиральной резьбой. Гвозди с текстурированной головкой можно использовать для уменьшения глянцевых пятен на ногтях при отделке (типы ногтей см. На Рисунке 2).
    Гвозди следует забивать осторожно. Сильные гвозди деформируют дерево и могут вызвать раскалывание. В скошенных углах, на краях и на концах, возможно, потребуется предварительно просверлить отверстия для гвоздей, чтобы избежать раскола.
    Размер используемых гвоздей зависит от типа и толщины сайдинга.Хорошая строительная практика заключается в использовании гвоздей, достаточно длинных, чтобы пройти через лежащие в основе материалы, такие как обшивка и изоляция, и проникнуть как минимум на 1-1 / 2 дюйма в массивную древесину или на 1-1 / 4 дюйма при использовании гвоздей с кольцевым или спиральным стержнем. . См. Таблицу 3 для получения информации о рекомендуемой длине гвоздей для сайдинга различной толщины.

    Сайдинг должен быть прикреплен к каждой стойке или полосе обрешетки гвоздями, расположенными максимум на 24 дюйма по центру. Размещение гвоздей зависит от рисунка сайдинга и ширины. Главное - надежно закрепить сайдинг, не мешая ему двигаться в ответ на влажность воздуха.В общем, каждый кусок сайдинга нужно прибивать самостоятельно.
    Склеивание частей внахлест вместе ограничивает естественное движение каждой части и вызовет раскол.

    Таблица 3. Минимальная рекомендуемая длина гвоздей для сайдинга из кедра поверх деревянной обшивки (прибивается на шпильках)

    Тип сайдинга Толщина сайдинга Тип и длина гвоздя (дюймы)
    Гладкий хвостовик Кольцо или спиральный хвостовик
    Наклон 1/2 2-1 / 4 (7д) 2 (6д)
    5/8 2-1 / 4 (7д) 2 (6д)
    3/4 2-1 / 2 (8д) 2-1 / 4 (7д)
    7/8 до 15/16 3 (10д) 3 (10д)
    5/4 шпунт 3 (10д) 3 (10д)
    Платы, T&G и канал 5/8 2-1 / 4 (7д) 2 (6д)
    3/4 2-1 / 4 (7д) 2 (6д)
    7/8 2-1 / 2 (8д) 2-1 / 4 (7д)
    Рейки для доски и обрешетки 3/4 3-1 / 4 (12д) 3 (10д)

    Было установлено, что гвозди из нержавеющей стали, не вызывающие коррозии, лучше всего подходят для наружного использования или для использования внутри помещений с высокой влажностью.Bear Creek Lumber рекомендует эти типы креплений. Ниже: изображения проекта, на котором в качестве сайдинга использовался желтый кедр Аляски. Подрядчик установил шпунтованный сайдинг с помощью обычных гвоздей. Несмотря на то, что сайдинг прибит слепыми гвоздями, на всей его поверхности видны черные полосы коррозии. Мы включаем эти изображения на страницу Western Red Cedar, потому что вы должны ожидать таких же полос и с Red Cedar.

    Регулирование экспрессии PBX3 андрогеном и Let-7d при раке простаты Научно-исследовательская работа по «Биологическим наукам»

    ИССЛЕДОВАНИЯ

    МОЛЕКУЛЯРНЫЙ РАК

    Открытый доступ

    Регулирование экспрессии PBX3 андрогеном и Let-7d при раке простаты

    10 1 1 О 1

    Hakon Ramberg ', Ayham Alshbib', Viktor Berge, Aud Svindland и Kristin Austlid Tasken '

    Аннотация

    Предпосылки: Фактор транскрипции 3 (PBX) прелейкемии является частью семейства транскрипционных факторов PBX, которые, как известно, регулируют гены, участвующие в дифференцировке мочеполовых органов и стероидогенезе.Это представляет интерес в отношении прогрессирования рака простаты, поскольку регуляция стероидогенеза является одним из механизмов, участвующих в развитии устойчивого к кастрации рака простаты. В свете этого мы хотели исследовать возможное участие андрогенной регуляции экспрессии PBX3 в раке простаты.

    Результаты: В этом исследовании мы показываем, что PBX3 посттранскрипционно регулируется андрогеном в клетках рака простаты и что этот эффект может быть независимым от рецептора андрогена.Кроме того, PBX3 был идентифицирован как мишень для Let-7d, андроген-регулируемой микроРНК. Let-7d подавлялся в злокачественной ткани по сравнению с доброкачественной тканью простаты, тогда как наблюдалась повышающая регуляция экспрессии PBX3.

    Выводы: Мы демонстрируем, что PBX3 активируется при раке простаты и посттранскрипционно регулируется андрогеном через Let-7d.

    Фон

    Факторы транскрипции играют ключевую роль в канцерогенезе из-за их функции активаторов и репрессоров экспрессии генов.Эта ключевая функция также подчеркивает их потенциальную роль в качестве мишеней для лекарств-кандидатов и прогностических или диагностических маркеров.

    Факторы транскрипции пре-B-клеточного лейкоза (PBX) являются членами семейства генов гомеобокса TALE (удлинение трех аминокислотной петли). Они участвуют в регуляции экспрессии генов развития, дифференцировке мочеполовых органов и стероидогенезе благодаря своей способности образовывать гетероолигомерные комплексы ДНК [1,2]. Белки PBX взаимодействуют с подмножеством белков HOX и с подсемейством Meinox белков класса TALE для повышения их аффинности и специфичности связывания с ДНК.PBX1 человека был первоначально идентифицирован как протоонкоген в пре-В-клеточном остром лимфобластном лейкозе, где он экспрессируется как слитый белок с E2A после хромосомной транслокации [3,4]. Позже PBX2, PBX3 и PBX4 были идентифицированы как другие члены семейства PBX на основании их высокой степени последовательности

    * Для переписки: [email protected]

    1 Отделение факультета Больница Университета Акера, Университет Осло, Клиника урологического университета Осло, Больница Университета Осло, Акер, N-0514 Осло, Норвегия Полный список сведений об авторах приведен в конце статьи

    Bio Med Central

    внутри и фланкирует их ДНК-связывающие гомодомены [5,6].Альтернативный сплайсинг транскриптов PBX дает высокомолекулярные (PBX1a, PBX2, PBX3a и PBX4) и низкомолекулярные (PBX1b и PBX3b, c, d) белки [7].

    Биохимические исследования и профили экспрессии белков PBX показывают, что они имеют как перекрывающиеся, так и специфические функции [1]. И PBX1, и PBX3 экспрессируются в коре развивающихся надпочечников, где они играют значительную роль в регуляции стероидогенеза [8,9]. В частности, было показано, что PBX опосредует индуцированную АКТГ экспрессию CYP17A1 (17альфа-гидроксилаза цитохрома P-450), ключевого фермента, необходимого для биосинтеза кортизола и андрогенов [10].Было также показано, что члены семейства PBX регулируют метаболизм андрогенов в клетках рака простаты, модулируя экспрессию UGT2B17, фермента, участвующего в глюкуронизации андрогенов [11].

    PBX3 высоко экспрессируется в развивающейся центральной нервной системе (ЦНС), но в остальном экспрессируется на низком уровне в ранней фазе органогенеза у мышей. Кроме того, вследствие его роли в ЦНС, мыши с дефицитом PBX3 развиваются до срока, но умирают в течение нескольких часов из-за центральной дыхательной недостаточности.Позже PBX3

    © 2011 Ramberg et al; лицензиат BioMed Central Ltd. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе, при условии правильного цитирования оригинальной работы.

    становится более широко экспрессироваться в эпителиальной и мезенхимальной ткани по всему эмбриону [12].

    Поскольку регуляция стероидогенеза является одним из механизмов, участвующих в развитии резистентного к кастрации рака простаты, мы хотели изучить экспрессию и регуляцию PBX3 при раке простаты.Более того, предыдущие исследования постулировали, что паттерн экспрессии PBX может быть использован как инструмент для стратификации и лечения пациентов с раком [13]. Одним из возможных вариантов лечения является использование синтетических пептидов, которые действуют как антагонисты, блокируя образование димера HOX / PBX. Сообщалось, что этот подход подавляет пролиферацию клеточных линий рака яичников, почек, немелкоклеточного рака легких и рака поджелудочной железы [14-17].

    Результаты

    Андрогенная регуляция PBX3 на уровне белка в клеточных линиях рака простаты

    Чтобы определить, регулируется ли экспрессия PBX3 андрогеном на уровне белка, мы стимулировали клетки LNCaP 10-10 M R1881, синтетическим аналогом андрогена, в течение от 1 до 4 дней с последующей экстракцией белка и вестерн-анализом с использованием анти-человеческого PBX3. антитело.Понижающая регуляция PBX3 была обнаружена через 24 часа стимуляции R1881 и далее снижалась после 4 дней лечения (рис. 1A). Андрогенная регуляция PBX3 также наблюдалась в клеточных линиях LNCaP C4-2B (C4-2B) и RWPE-1 (рис. 1B), а также при стимуляции клеток LNCaP дигидротестостероном (дополнительный файл 1: рис.S1). Сверхэкспрессия PBX3 путем трансфекции клеток LNCaP (фиг. 1A) и конкуренция с конкурирующим пептидом (данные не показаны) были использованы для подтверждения специфичности антитела против PBX3.Уровень PBX3 не изменялся в необработанных LNCaP-клетках в течение экспериментального периода (данные не показаны).

    Независимая регуляция андрогенных рецепторов PBX3

    Чтобы изучить роль рецептора андрогена (AR) в андрогенной регуляции PBX3, клетки LNCaP стимулировали R1881 в отсутствие и в присутствии бикалутамида (Bic), антагониста AR (рис. 2A). Незначительное снижение уровня PBX3 наблюдалось в присутствии одного бикалутамида, а дальнейшее снижение наблюдалось при добавлении R1881.Трансфекция клеток LNCaP siRNA, нацеливающая на AR, не влияла на уровень PBX3, тогда как уровень самого AR и NKX3.1, известного регулируемого андрогенами гена, был снижен (рис. 2B).

    Посттранскрипционная регуляция PBX3 андрогеном

    Интересно, что не было обнаружено значительных изменений в уровне мРНК PBX3 между контрольными (CSS) и андроген-стимулированными (R1881) клетками LNCaP, и никакого эффекта

    не обнаружено.

    м> о. .2

    01 c> ü J2 o

    1881 рэнд (сутки)

    а-тубулин

    а) с> 5 ti

    RCO 2 Q

    1881 рэнд (сутки)

    АТС3 а-тубулин

    □ CSS | R1881

    PBX3 PRKAR1A

    RWPE-1

    Рисунок 1 Андрогенная регуляция PBX3 в клеточных линиях рака простаты.Клетки LNCaP стимулировали 10-10 М R1881 (R1881) или оставляли необработанными (CSS) в течение 1-4 дней перед экстракцией белка. A) Показаны репрезентативные вестерн-блоты, зондированные антителом против PBX3 человека (верхняя панель) и антителом против тубулина в качестве контроля нагрузки (нижняя панель). В полосе справа показаны клетки LNCaP, трансфицированные плазмидой экспрессии PBX3 (PBX3-SPORT6). Результаты денситометрического анализа полосы PBX3 относительно CSS показаны на гистограмме выше. B) Репрезентативные вестерн-блоты клеток C4-2B и RWPE-1, стимулированных 10-10 М R1881 и зондированных антителом против PBX3, показаны на верхних панелях.Антитело против тубулина (C4-2B) или антитело против PRKAR1A (RWPE-1) показаны в качестве контроля загрузки (нижние панели). Данные были получены из трех независимых экспериментов и представлены на гистограммах как среднее ± стандартное отклонение (n = 3). Был проведен t-тест (две пары средних выборок), и двустороннее значение p <0,05 обозначено *.

    Наблюдалось

    бикалутамида (Bic) (дополнительный файл 2: рис. S2A). Чтобы определить, влияет ли андроген на синтез белка и / или деградацию PBX3 на уровне белка, клетки LNCaP стимулировали андрогеном в присутствии или в отсутствие циклогексимида, ингибитора синтеза белка.Никакого значимого эффекта андрогена не было.

    J5 1,0

    м X ок.

    ERK1 / 2

    R1881 Бик

    a> 1,5 ■

    '3 1,0 ■

    а. > 0,5 ■

    □ siRNActr. ■ siRNAAR

    а-тубулин

    NKX3.1

    Рис. 2. Независимая от рецептора андрогена регуляция PBX3 с помощью R1881.А) Клетки LNCaP предварительно обрабатывали в течение 3 дней средой, содержащей 10% CSS. Затем клетки стимулировали 10-10 М R1881 (R1881) и / или 10-8 М бикалутамидом (R1881 + Bic или Bic) или оставляли без обработки (CSS) в течение 4 дней. Экстракты общего белка анализировали вестерн-блоттингом с использованием антитела против PBX3 и анти-ERK 1/2 в качестве контроля загрузки. Результаты денситометрического анализа полосы PBX3 относительно CSS показаны на гистограмме. B) Клетки LNCaP трансфицировали небольшой мешающей РНК против рецептора андрогенов (siRNA AR) и анализировали на экспрессию PBX3 через 48 часов после трансфекции.Неспецифическую малую интерферирующую РНК (siRNA Ctr.) Использовали в качестве контроля. Репрезентативные вестерн-блоты, зондированные антителами против PBX3, против AR, против NKX3.1 и против тубулина, показаны на рисунке. Гистограммы отображают результаты денситометрического анализа PBX3 и AR относительно Ctr siRNA. Данные были получены из трех независимых экспериментов и представлены на гистограммах как среднее ± стандартное отклонение (n = 3). Был проведен t-тест (две пары средних выборок), и двустороннее значение p <0,05 обозначено *.

    наблюдается на уровне экспрессии PBX3, когда синтез белка ингибируется. Это указывает на то, что андроген может влиять на трансляцию / синтез PBX3 или что андроген косвенно регулирует стабильность белка PBX3 (дополнительный файл 2: рис.S2B).

    Let-7d регулирует PBX3 в ячейках LNCaP

    Одним из возможных механизмов, посредством которого андроген может регулировать синтез белка PBX3, является микро-РНК, которая преимущественно действует путем связывания с 3'-нетранслируемой областью (3'UTR) специфических мРНК.МикроРНК, которая может регулировать экспрессию PBX3, была идентифицирована с помощью анализов in silico с использованием трех различных доступных пакетов программного обеспечения для биоинформатического анализа: miRANDA, TargetScan и PicTar [18-20]. Предполагаемые сайты связывания для Let-7d, miR-101 и miR-222 были идентифицированы в 3'UTR PBX3 с помощью всех трех биоинформатических программ (Таблица 1). Трансфекция клеток LNCaP тремя микроРНК, идентифицированными in silico, показала, что миметик Let-7d снижает уровень эндогенного белка PBX3 через 48 часов после трансфекции, демонстрируя, что Let-7d потенциально регулирует экспрессию PBX3 (рис. 3A).MiR-101 и miR-222, по-видимому, не влияют на уровень PBX3 в клетках LNCaP. Умеренное повышение регуляции PBX3 наблюдалось при трансфекции клеток LNCaP с помощью мимического ингибитора шпильки Let-7d (Anti-Let-7d), который блокирует микроРНК Let-7d (рис. 3A). Трансфекция клеток C4-2B и RWPE-1 миметиком Let-7d подавляла экспрессию эндогенного PBX3 (рис. 3B).

    Предполагаемый сайт связывания Let-7d в области 3'UTR PBX3 изображен на фиг. 4A. Последовательность 3'UTR PBX3 клонировали в плазмиду pMIR-Luc и трансфицировали в клетки LNCaP.Присутствие 3'UTR PBX3 (pMIR-Luc-PBX3-3'UTR) снижает активность люциферазы по сравнению с пустой репортерной плазмидой (pMIR-Luc), как и следовало ожидать, если бы микроРНК регулировала экспрессию PBX3 (рис. 4B). . Не наблюдалось значительного эффекта, когда последовательность 3'UTR PBX3 была клонирована в pMIR-Luc в обратной ориентации (pMIR-Luc-PBX3-Rev3'UTR). Чтобы проверить, регулирует ли Let-7d экспрессию PBX3, репортерная конструкция pMIR-Luc-

    Таблица 1 Прогнозируемые сайты связывания микроРНК в PBX3 3'UTR

    регион

    микроРНК miRANDA TargetScan PicTar Prostate Cancer

    miR-23a + НД НД +

    миР-92 а / б + НД НД +

    miR-101 + + + +

    miR-202 + ND ND +

    miR-222 + + + +

    miR-320 без даты + без даты +

    лет-7а НД + НД +

    лет-7д + + + +

    лет-7г НД + НД +

    Был создан список дифференциально регулируемых микроРНК в доброкачественной и злокачественной ткани предстательной железы, и потенциальные сайты связывания в области 3'UTR PBX3 были идентифицированы с использованием программного обеспечения для прогнозирования мишеней микроРНК.ND означает, что программа не обнаружила / не предсказала сайт связывания. Столбец, обозначенный «Рак предстательной железы», указывает на то, что микроРНК по-разному регулируется в доброкачественной и злокачественной ткани простаты.

    ä 1,2 или

    а-тубулин

    Ctr. miR-101 miR-222 Let-7d Ctr. Анти-Лето-7д

    RWPE-1

    а-тубулин

    PRKAR1A

    Ctr.Let-7d Ctr. Let-7d Рисунок 3 Регулирование микроРНК эндогенной экспрессии PBX3.

    A) Клетки LNCaP трансфицировали 5'10-8 М miR-101, miR-222, Let-7d или контрольную микроРНК (Ctr.), Как показано на левой панели. На правой панели показана трансфекция клеток LNCaP 10-7M ингибитором шпильки, имитирующим Let-7d. Общий белок экстрагировали из клеток через 48 часов после трансфекции. Вестерн-анализ выполняли с антителами против PBX3 и против а-тубулина в качестве контроля нагрузки. Показаны репрезентативные вестерн-блоты, а результаты денситометрического анализа трех независимых экспериментов представлены на гистограммах выше (среднее ± стандартное отклонение (n = 3)).Был проведен t-тест (две пары средних выборок), и двустороннее значение P <0,05 обозначено знаком *. B) Трансфекция, имитирующая Let-7d, клеток C4-2B и RWPE-1 с последующим определением уровней эндогенного PBX3 вестерн-анализом. Антитела против a-тубулина (C4-2B) и против PRKAR1A (RWPE-1) использовали в качестве контрольных нагрузок. Представлены репрезентативные вестерн-блоты.

    PBX3-3'UTR котрансфицировали с миметиком Let-7d в клетки LNCaP. Котрансфекция миметика Let-7d снижает активность люциферазы, генерируемую pMIR-Luc-PBX3-3'UTR (фиг. 4C).Эффект Let-7d блокировали путем мутации предполагаемого сайта связывания Let-7d в последовательности 3'UTR PBX3 (PBX3 3'UTRmut).

    Андрогенная регуляция Let-7d в клеточных линиях рака простаты

    Андрогенная регуляция PBX3 через Let-7d была дополнительно исследована путем измерения уровней Let-7d после стимуляции R1881. Клетки LNCaP, C4-2B и RWPE-1 стимулировали 10-10 М R1881 в течение 24 часов, и уровень Let-7d измеряли с помощью sqRT-PCR. Как показано на фиг. 5, через 24 часа обработки андрогенами наблюдалась повышающая регуляция Let-7d по сравнению с нестимулированными клетками.

    1275 п.н. 1373 п.н.

    Лет-7д

    Pbx3 3'UTR

    2760 п.н.

    2219 п.н.

    2225 п.н.

    ... AAAACACAGCUUUAUUACCUCAU ..

    Я Я Я Я Я Я

    Лет-7д УУГАУАКГУУГГАУГАУГГАГА

    5,0 4,0 3,0 2,0 1,0 0,0

    2,0 ​​1,5 1,0 0,5 0,0

    PBX3 PBX3 3'UTR Ред. 3'UTR

    пМИР-Люк

    Лет-7д

    Лет-7д

    PBX3 3'UTR

    PBX3 3'UTRmut

    Рисунок 4 PBX3 - это ген-мишень Let-7d.A) Схематическое представление последовательности 3'UTR PBX3, включенной в репортерные плазмиды. Зрелая последовательность Let-7d показана внизу, а предполагаемая область связывания Let-7d подчеркнута. Подчеркнутые нуклеотиды удалены в плазмиде pMIR-Luc-PBX3-3'UTR-Mut. B) Клетки LNCaP, временно трансфицированные либо пустым вектором (pMIR-Luc), либо репортерными плазмидами, содержащими 3'UTR-PBX3 либо в правильной (pMIR-Luc-PBX3 3'UTR), либо в обратной ориентации (pMIR-Luc-PBX3 3). 'UTR-Rev) и измеряли репортерную активность.C) Репортерные плазмиды, содержащие 3'UTR PBX3 с присутствующим сайтом связывания Let-7d дикого типа (pMIR-Luc-Pbx3 3'UTR, помеченный PBX3 3'UTR) или удаленным (PBX3 3'UTRmut), трансфицировали в Клетки LNCaP в отсутствие или в присутствии 5-10-8 миметика Let-7d. Клетки собирали через 48 часов после трансфекции. Активность люциферазы с поправкой на активность р-галактозидазы показана на гистограммах. Данные представлены как среднее ± стандартное отклонение (n = 3) относительно клеток LNCaP, трансфицированных 3'UTR PBX3. Был проведен t-тест (две пары средних выборок), и двустороннее значение p <0,05 обозначено *.

    IS у.е. 0 £

    Ctr. LNCaP C4-2B RWPE-1

    Рисунок 5 Андрогенная регуляция Let-7d в клеточных линиях рака простаты. Клетки LNCaP, C4-2 и RWPE-1 стимулировали 10-10 М R1881 (R1881) или оставляли без обработки (Ctr) в течение 24 часов. Уровни Let-7d определяли количественно с помощью sqRT-PCR. Для нормализации использовали микроРНК RNU6B. Данные представлены как среднее ± стандартное отклонение (n = 3) относительно соответствующих необработанных клеток. Был проведен t-тест (две пары средних выборок), и двустороннее значение P <0,05 обозначено знаком *.

    Экспрессия PBX3 и уровни Let-7d в образцах простаты

    Срезы микромассивов тканей с 21 ядром доброкачественной и 30 злокачественной ткани пациента, перенесшего лапароскопическую простатэктомию в клинике урологического университета Осло (Норвегия), были проанализированы на экспрессию PBX3 с помощью иммуногистохимического окрашивания, как показано на рисунке 6A. PBX3 был обнаружен в ядре базальных клеток в доброкачественных областях, тогда как цитоплазматическая экспрессия PBX3 наблюдалась при злокачественном раке простаты.Оценка интенсивности окрашивания показала, что уровень PBX3 был повышен в злокачественной ткани по сравнению с доброкачественной тканью (Рисунок 6B). Был предварительно сформирован критерий хи-квадрат Пирсона, показавший значительную разницу (p <0,001) между экспрессиями PBX3 в доброкачественной ткани по сравнению со злокачественной тканью рака простаты.

    Мы наблюдали повышенную регуляцию PBX3 на уровне белка при злокачественном раке простаты, тогда как анализ экспрессии Let-7d в 18 сопоставленных доброкачественных и злокачественных образцах из образцов простатэктомии показал понижающую регуляцию Let-7d в злокачественных образцах по сравнению с образцами доброкачественной ткани. (Рисунок 6C).

    Обсуждение

    Это исследование показывает, что PBX3 посттранскрипционно регулируется андрогеном в клеточных линиях рака простаты. Кроме того, PBX3 идентифицирован как мишень для Let-7d, андроген-регулируемой микроРНК, что указывает на то, что андроген регулирует экспрессию PBX3 посредством Let-7d. АТС3 была

    Доброкачественные

    Злокачественный

    2,5> 2,0

    ~ 1,0 ттт c

    C 0,5 "¡5

    Доброкачественные

    Злокачественный

    Лет-7д

    Доброкачественные

    Злокачественный

    Рисунок 6. Экспрессия Let-7d и PBX3 в образцах рака простаты человека.A) Репрезентативные изображения доброкачественной и злокачественной ткани предстательной железы, иммуногистохимически окрашенной антителом против человеческого PBX3. B) Слайды ТМА с ядрами доброкачественной (n = 21) и злокачественной (n = 30) ткани предстательной железы иммуногистохимически окрашивали антителом против PBX3 и оценивали в соответствии с интенсивностью окрашивания от 0 до 3. B) Уровни Let-7d в доброкачественных и образцы злокачественной ткани предстательной железы (n = 18) из клиники урологического университета Осло были количественно определены с помощью sqRT-PCR. Для нормализации использовали микроРНК RNU6B.Был проведен критерий хи-квадрат Пирсона, показавший значительную разницу (p <0,001). Вертикальные линии в каждом поле представляют собой медианное значение, а усы показывают 95% доверительный интервал.

    активируется, а Let-7d подавляется при раке простаты по сравнению с нормальными эпителиальными клетками простаты.

    Андрогенная регуляция PBX3 была преимущественно посттранскрипционной, поскольку не было обнаружено регуляции PBX3 на уровне мРНК после стимуляции андрогеном.Это контрастирует с регуляцией PBX1, ранее идентифицированного как ген-мишень для PLZF (цинковый палец проми-локитической лейкемии), раннего андроген-чувствительного гена [21]. Кикугава и его коллеги показали, что PBX1 регулируется после обработки андрогеном в клетках DU145, трансфицированных рецептором андрогенов, что указывает на то, что PBX1 косвенно регулируется андрогенами через PLZF. В то время как предполагаемые сайты связывания PLZF присутствуют в промоторе PBX1 [22], предварительный анализ с использованием программного обеспечения TFSEARCH нашей группой не выявил предполагаемых сайтов связывания PLZF в вышестоящей области гена PBX3 человека (данные не показаны) [23] .Предыдущие исследования показали, что полностью транс-ретиноевая кислота индуцировала экспрессию PBX1 на уровне мРНК в клетках эмбриональной карциномы P19, тогда как уровень мРНК PBX3 оставался неизменным. Однако уровень белка PBX3 был индуцирован полностью транс-ретиноевой кислотой [24,25].

    Интересно, что наши данные показывают, что андроген регулирует экспрессию PBX3 независимо от AR, поскольку эффект R1881 наблюдался в клетках LNCaP, трансфицированных siRNA, нацеленными на AR, и в клетках RWPE-1, которые экспрессируют очень низкие уровни AR (не обнаруживаются на Вестерн-блоттинге). [26].Эффект андрогена также наблюдался в присутствии бикалутамида, антиандрогена. Хотя большинство эффектов андрогенов опосредовано АР, некоторые реакции, такие как повышение внутриклеточного кальция и концентрации цАМФ, по-видимому, имеют место независимо от АР в некоторых типах клеток [27]. Необходимы дальнейшие исследования для изучения молекулярных механизмов, вовлеченных в независимые от АР эффекты андрогенов.

    Поскольку в нашем исследовании андроген не влиял на уровень мРНК PBX3 или стабильность белка, мы предположили, что андроген может регулировать синтез белка PBX3 через микроРНК.МикроРНК представляют собой короткие олигонуклеотиды длиной 28-24 нуклеотида, которые связываются с 3'-нетранслируемой областью (3'UTR) их генов-мишеней. Связывание зрелой микроРНК с РНК-индуцирующим комплексом сайленсинга (RICS) может инициировать ингибирование трансляции и деградацию РНК. Предполагаемые сайты связывания для трех микроРНК, miR-101, miR-222 и Let-7d были идентифицированы в области 3'UTR гена PBX3 с использованием трех различных программ для прогнозирования мишеней микроРНК. В этом исследовании мы сосредоточились на Let-7d, поскольку трансфекция миметиком Let-7d, в отличие от трансфекции миметиков miR-101 и miR-222, снижает уровень белка эндогенного PBX3 в клетках LNCaP.

    Let-7d - это микроРНК, которая является частью семейства Let-7 [28]. Было показано, что многие из 13 членов семьи Let-7 регулируются при раке простаты [29-33].

    Интересно, что Let-7d был недавно идентифицирован как регулируемая андрогеном микроРНК в клеточных линиях LNCaP и LAPC-4 после анализа микрочипов, что подтверждает наши данные, указывающие на андрогенную регуляцию синтеза PBX3 посредством Let-7d [34]. Семейство Let-7 участвует в нормальном развитии и дифференцировке и, как было показано, действует как опухолевые супрессоры при многих раковых заболеваниях человека [28].В клетках LNCaP недавно было показано, что Let-7a обладает антипролиферативным действием [35]. Нам удалось обнаружить снижение жизнеспособности клеток LNCaP, трансфицированных Let-7d (данные не показаны), что демонстрирует возможную функцию супрессора опухоли семейства Let-7 при раке простаты, функцию, которая поддерживается наблюдаемым подавлением активности Let-7d. Экспрессия -7d в злокачественной ткани по сравнению с доброкачественной тканью рака простаты. В двух исследованиях ранее сообщалось о снижении регуляции Let-7d при злокачественных новообразованиях по сравнению с доброкачественной тканью предстательной железы с использованием микрорентгеноспектрального анализа [29,30], тогда как в третьем исследовании Volinia et.al. показали повышенную регуляцию Let-7d в злокачественной ткани простаты [36].

    В то время как экспрессия Let-7d была снижена при раке простаты, повышенная экспрессия PBX3 наблюдалась в злокачественной ткани предстательной железы по сравнению с доброкачественной при иммуногистохимическом окрашивании образцов простаты моноклональным антителом, специфичным против PBX3 человека. Мы наблюдали ядерное окрашивание базальных клеток в доброкачественной ткани простаты и не обнаруживали окрашивания просветных клеток. Однако в злокачественной ткани окрашивание было обнаружено как в цитоплазме, так и в ядре секреторных клеток просвета.В предыдущей работе Crijns и его коллег [37] сообщалось об усилении иммуногистохимического окрашивания PBX как в цитоплазме, так и в ядрах опухолевых клеток яичников с использованием антитела против PBX1 / 2/3/4, которое не различает различных членов PBX. Будущие исследования покажут, играет ли PBX3 потенциальную роль в качестве биомаркера или лекарственной мишени при раке простаты, как показано при других типах рака [14-17].

    Выводы

    Здесь мы впервые демонстрируем, что PBX3 активируется в злокачественной ткани простаты.Представленные результаты показывают, что андроген регулирует экспрессию PBX3 через Let-7d в тестируемых клеточных линиях рака простаты. Это представляет интерес в свете роли андрогенов в прогрессировании рака простаты и роли микроРНК в регуляции экспрессии генов на посттранскрипционном уровне. Предполагаемое участие PBX в регуляции дифференцировки и стероидогенеза делает членов PBX интересными кандидатами для терапевтического воздействия на более поздних стадиях рака простаты. Поэтому было бы интересно установить, может ли нарушение образования комплекса транскрипции PBX с использованием PBX-связывающих пептидов, таких как HXR9, остановить прогрессирование поздних стадий рака простаты.г / мл пенициллина и 5% FCS). Все клеточные линии поддерживали при 37 ° C в инкубаторе, увлажненном 5% CO2. CSS получали обработкой FCS углем при перемешивании при 4 ° C в течение ночи с последующим центрифугированием и стерильной фильтрацией. R1881 / Метилтриенолон был приобретен в Roussel-UCLAF (Роменвиль, Франция), а бикалутамид был приобретен у Astra Zeneca (Чешир, Великобритания). Все остальные соединения были от Sigma (Сент-Луис, Миссури), если не указано иное.

    Стимуляция клеточных линий рака простаты

    LNCaP и C4-2 были предварительно обработаны в течение 3 дней (рис. 1, 2) или 24 часов (рис. 5) средой, содержащей 10% CSS, перед стимуляцией.г / мл циклогексимида. Циклогексимид и бикалутамид добавляли за 2 часа до R1881. Клетки, инкубированные в 10% CSS на протяжении всего эксперимента, использовали в качестве контроля. Клетки RWPE-1 не подвергались предварительной обработке, поскольку их культивировали в бессывороточной среде.

    Полуколичественная ОТ-ПЦР в реальном времени (sqRT-PCR)

    Общую РНК

    выделяли с использованием Trizol ™ от Invitrogen (Карлсбад, Калифорния). 100 нг тотальной РНК были включены в одностадийную реакцию ОТ-ПЦР с использованием набора QuantiTect SYBR Green RT-PCR от Qiagen (Хильден, Германия), которую проводили с использованием MJ Research DNA Engine Opticon Continuous Fluorescence Detection System от MJ Research Inc.(Уолтан, Массачусетс). Условия цикла ОТ-ПЦР были следующими; обратная транскрипция при 50 ° C в течение 30 минут и стадия инактивации 95 ° C в течение 15 минут, затем 40 циклов ПЦР (15 секунд при 94 ° C, 30 секунд при 55 ° C, 30 секунд при 72 ° C) и заключительный удлинение при 72 ° C в течение 5 минут с последующим анализом кривой плавления. G6PD использовался для нормализации. Формулу AACt использовали, как описано в протоколе от Applied Biosystems (Фостер-Сити, Калифорния). Были использованы следующие праймеры; G6PD [NM_000402]:

    tgcatgagccagataggc и acagggaggagatgtggttg; PBX3 [NM_006195]: gcattaatcattacatcg и tgacagttcaggg-catgttt.Анализ микроРНК Taqman от Applied Biosystems использовали для обнаружения и количественного определения экспрессии Let-7d. 10 нг общей РНК использовали в двухэтапной реакции ОТ-ПЦР с набором для анализа hsa-Let-7d Taqman® MicroRNA (Applied Biosystems, № по каталогу 4395394), набором для обратной транскрипции Taqman® MicroRNA (Applied Biosystems, № по каталогу) 4366596) и Taqman® 2X Universal PCR Master Mix (Applied Biosystems, № по каталогу 4324018) в соответствии с протоколами производителя. Тест RNU6B Taqman® MicroRNA (Applied Biosystems, Cat.№ 4373381) использовалась для нормализации. Формулы AACt и ACt использовали, как описано в протоколе от Applied Biosystems (Фостер-Сити, Калифорния).

    Экстракция белка и вестерн-анализ

    Клетки собирали в PBS и лизировали в буфере RIPA (25 мМ Tris-HCl pH 7,6, 150 мМ NaCl, 1% NP-40, 0,1% SDS) и в таблетках полного ингибитора протеазы от Roche (Мангейм, Германия) с последующими 30 мин. вращение при 4 ° C. Лизат центрифугировали при 10000 g в течение 30 мин и количество белка в супернатанте оценивали с помощью набора для анализа белка Bradford от Bio-Rad Laboratories (Hercules, CA).г / дорожку) и MagicMark (Invitrogen Carlsbad, CA) разделяли на гелях NuPAGE с градиентом 10% или 4-12% Bis-Tris от Invitrogen (Carlsbad, CA) и переносили на мембраны PVDF, приобретенные у Millipore Corporation (Billerica, MA), с помощью мокрый электроблоттинг. Мембраны блокировали в 5% (мас. / Об.) Сухом обезжиренном молоке в трис-буферном солевом растворе, содержащем 0,1% (об. / Об.) Твин-20 (TBST), в течение 2 часов при комнатной температуре (RT), а затем инкубировали в течение ночи при 4 ° C. ° C с соответствующим первичным антителом, разведенным в TBST. В качестве первичных используемых антител использовали мышиные моноклональные антитела против PBX3 от Abnova Corporation (Гейдельберг, Германия), антитела против PRKAR1A от Transduction Laboratories (Франклин-Лейкс, штат Нью-Джерси), анти-ERK 1/2 от Cell Signaling Technology (Бостон, Массачусетс) и мышиные моноклональные антитела против a-тубулина от Sigma (St.Луис, Миссури). Антитело NKX3.1 было любезно предоставлено профессором Фахри Саатчиоглу из отдела молекулярных биологических наук Университета Осло, Норвегия. Мембраны промывали 3 × 10 мин TBST и дополнительно инкубировали в течение 1 часа с вторичными антителами, конъюгированными с пероксидазой хрена против мышиных или кроличьих IgG, от Jackson ImmunoResearch Ltd (Кембриджшир, Великобритания). После промывки 3 × 10 мин мембраны проявляли с использованием Immobilon ™ Western от Millipore (Billerica, MA). Изображения были созданы с помощью цифровой камеры Hamamatsu от Syngene

    .

    (Кембридж, Великобритания) и количественно оценивали с помощью программного обеспечения Multi Gauge от FujiFilm (Бедфорд, Великобритания).

    Образец ткани предстательной железы

    Сопоставленные доброкачественные и злокачественные ткани предстательной железы для анализа мРНК и иммуногистохимического окрашивания были получены в результате радикальной простатэктомии 18 и 30 пациентов с раком простаты соответственно, пролеченных в Урологической университетской клинике Осло, и получены из «Биобанка простаты» - ресурса для урологических исследований Норвегия »(10974). Образцы ткани обрабатывали RNALater при 4 ° C в течение ночи в соответствии с протоколом производителя (Qiagen, Hilden, Германия) и хранили при -80 ° C.Патология образцов была проверена опытным уропатологом (AS). Письменное согласие было получено от всех пациентов, и проект был одобрен Региональным комитетом по этике медицинских и медицинских исследований.

    Иммуногистохимия

    Иммуногистохимическое окрашивание срезов ткани, залитых парафином, проводили в соответствии с протоколом производителя с использованием системы обнаружения Ultravision One от LabVision (Фремонт, Калифорния) и системы ручного окрашивания IHC Select от Chemicon (Темекула, Калифорния).Срезы тканевых микрочипов (ТМА) депарафинизировали, и антиген извлекали в цитратном буфере (pH 6) в течение 30 минут при 100 ° C в модуле PT от Lab-Vision (Суффолк, Великобритания). Срезы ТМА инкубировали с антителом против PBX3 человека (разведение 1:50). Неиммунный IgG от Vector Laboratories Inc. (Burlingame, CA) использовали в качестве отрицательного контроля. Слайды обрабатывали гематоксилином в течение 70 с. Ручная оценка окрашивания проводилась опытным патологом, который также проверял все патологические градации (AS).Микроматрица тканей образцов радикальной простатэктомии содержала доброкачественные и злокачественные ткани от 30 пациентов. Изображения были получены с помощью микроскопа Leica DM RA2 и камеры Leica DC 300F.

    Плазмиды

    Вектор экспрессии PBX3-SPORT6, содержащий полноразмерный клон кДНК PBX3 от Imagene (Imagene, IRATp970H04107D), использовали для сверхэкспрессии PBX3. Система репортерных векторов экспрессии miRNA pMIR-REPORT ™ (Applied Biosystems, Cat.№ AM5795), состоящий из люциферазы pMIR-REPORTER ™ и контрольной плазмиды p-gal pMIR-REPORTER ™. Первый (pMIR-Luc) использовали для создания люциферазных репортерных конструкций с 3'-нетранслированными областями PBX3 (нуклеотиды 1275-2760 NM_006195). Следующий набор праймеров PBX3 3'UTR; agacgggagctcatcaatcagacgggaggctac и agaataaagcttcat-tagaatcaccgccacaa, использовали для создания ампликона PBX3-3'UTR из вектора PBX3-Sport6 ​​и клонировали в репотерный вектор pMIR-Luc. Репортер вектор с

    Последовательность

    PBX3 3'UTR в обратной ориентации также была сконструирована с набором праймеров PBX3 Rev3'UTR; tgggactagtcctcattagaatcaccgccacaa и tcttataagctttcaat-cagacgggaggctac.Систему GeneAmp High Fidelity PCR от Applies Biosystems использовали в соответствии с протоколом производителя. Предсказанная область связывания семян Let-7d, tacctca, 3'UTR PBX3 была удалена с использованием набора для сайт-направленного мутагенеза QuickChange II (Stratagene, кат. № 200523). Следуя протоколу производителя, разработали и использовали два праймера для мутагенной делеции, которые использовали при конструировании pMIR-PBX3-3'UTR-Mut: ccaatcaaaacacagctt-tattgcgaactcatacaaacc и ggtttgtatgagttcgcaa-taaagctgtgttttgattgg.Все сконструированные плазмиды были проверены секвенированием в GATC Biotech (GATC Biotech, Германия).

    Трансфекция и анализ люциферазы

    Клетки высевали либо на чашки Петри (10 см) по 1 × 106 клеток на чашку, либо на 6-луночные планшеты по 300 000 клеток на лунку, либо на 96-луночные планшеты по 5000 клеток на лунку и культивировали в течение 3 дней в полной среде. Клетки трансфицировали плазмидами, указанными выше. Малая интерферирующая РНК (миРНК) против AR (Dharmacon, кат.KR0AA-005852) и miRNA hsa-Let-7d miRIDIAN Mimic (Dharmacon, Кат. № C-300478-07), hsa-Let-7d miRIDIAN Mimic Inhibitor (Dharmacon, Cat. No. C-300478-08) и miRI- DIAN microRNA Отрицательный контроль 1 (Dharmacon, Cat. No. CN-001000-01-05). Реагент для трансфекции DharmaFECT ™ Duo (Dharmacon Cat. No. T-2010-03), Dharma-FECT ™ 3 (Dharmacon Cat. No. T-2003-03) или Lipofecta-mine 2000 (Invitrogen) использовались в соответствии с протоколами производителя. с небольшими доработками. Клетки инкубировали в среде с сывороткой и без антибиотиков в течение 2 часов перед трансфекцией.Среду для трансфекции меняли через 4 часа трансфекции на среду с сывороткой и без антибиотиков, а затем инкубировали в течение 24 или 48 часов. Люциферазную активность измеряли с помощью системы анализа люциферазы (каталожный номер 1501, Promega, Мэдисон, Висконсин). Анализ бета-галактозидазы контрольной плазмиды pMIR-REPORTER ™ с β-галлом проводили с реагентами Galacto Plus и Emerald (Applied Biosystems). Мы следовали протоколу производителя. Мы использовали люминометр (TD-20/20 Turner Designs, Саннивейл, Калифорния) для измерения активности люциферазы и ß-галактозидазы.

    Дополнительный материал

    Дополнительный файл 1: Рисунок S1. Регулирование уровня белка PBX3 с помощью DHT в LNCaP. A) Клетки LNCaP предварительно обрабатывали в течение 3 дней 10% CSS и стимулировали дигидротестостероном (DHT) с различными концентрациями, как показано на рисунке, в течение 48 часов. Вестерн-блот анализировали антителом против PBX3. B) Репрезентативный вестерн-блот

    клеток LNCaP стимулировали 10 M R1881 в течение 1-4 дней с использованием антитела против PBX1 / 2/3/4.

    Дополнительный файл 2: Рисунок S2. PBX3 посттранскрипционно регулируется андрогеном. Клетки LNCaP предварительно обрабатывали в течение 3 дней средой, содержащей 10% CSS. Затем клетки стимулировали или оставляли без обработки (CSS). A) Тотальную РНК экстрагировали через 48 часов обработки 10-10 М R1881 (R1881) и / или 10-8 М бикалутамидом (R1881 + Bic или Bic), чтобы определить влияние R1881 на уровни экспрессии мРНК PBX3 с помощью sqRT-PCR относительно CSS. B) Клетки LNCaP либо оставляли необработанными (CSS), либо стимулировали 10-10 М R1881 (R1881) отдельно или в комбинации с 10 мкг / мл циклогексимида (R1881 + Cyc) в течение 48 часов.Клетки, стимулированные только циклогексимидом (Cyc), показаны в качестве контроля. Клетки предварительно обрабатывали циклогексимидом в течение 2 часов перед добавлением 10-10 М R1881. Вестерн-блоты зондировали антителом против PBX3 и анализировали денситометрически. Антитело против a-тубулина использовали в качестве контроля нагрузки. Данные представлены как среднее ± стандартное отклонение (n = 3).

    Благодарности

    Мы благодарим Отделение урологии и Отделение анатомии и патологии Университетской больницы Осло, Акер, и «Биобанк простаты - ресурс для урологических исследований в Норвегии» за клинические образцы.Кроме того, мы благодарим Олова Огрена за квалифицированную техническую помощь, Мортена Ванга Фагерланда за статистический анализ и доктора Турида Эйде за плодотворные обсуждения. Эта работа была поддержана Юго-Восточным регионом здравоохранения, Норвежским онкологическим обществом, Университетом Осло и университетской больницей Осло, Акер.

    Сведения об авторе

    факультетский отдел Университетская больница Акера, Университет Осло, Урологическая университетская клиника Осло, Университетская больница Осло, Акер, N-0514 Осло, Норвегия.2Факультетский отдел университетской больницы Акер, Университет Осло, отделение патологии, Университетская больница Осло, Акер, N-0514 Осло, Норвегия. 3 Отделение биологии опухолей, Институт исследования рака, Университетская больница Осло, Осло, Норвегия.

    Авторские взносы

    HR принимал участие в разработке исследования, проводил эксперименты и анализировал результаты, а также писал черновой вариант и окончательную рукопись. AA изучал регуляцию андрогенов PBX на уровне мРНК и белка в нетрансфицированных клеточных линиях рака простаты и принимал участие в составлении рукописи. VB участвовал в разработке дизайна исследования и статистическом анализе результатов иммуногистохимии и пересмотре окончательного проекта.AS оценил морфологию образцов ткани, оценил иммуногистохимическое окрашивание и участвовал в пересмотре окончательного проекта. KAT разработал исследование, проанализировал экспериментальные результаты и принял участие в написании проекта и редактировании окончательной рукописи. Все авторы прочитали и одобрили окончательный вариант рукописи.

    Конкурирующие интересы

    Авторы заявляют, что у них нет конкурирующих интересов.

    Получено: 6 октября 2010 г. Принято: 6 мая 2011 г. Опубликовано: 6 мая 2011 г.

    Список литературы

    1.Лоран А., Бихан Р., Омилли Ф., Дешам С., Пеллерин I: белки PBX: гораздо больше, чем кофакторы Hox. Int J Dev Biol 2008, 52: 9-20.

    2. Schnabel CA, Selleri L, Jacobs Y, Warnke R, Cleary ML: Экспрессия Pbx1b во время органогенеза млекопитающих. Mech Dev 2001, 100: 131-135.

    3. Кампс М.П., ​​Мюрр С., Сан XH, Балтимор Д.: Новый ген гомеобокса вносит вклад в ДНК-связывающий домен транслокационного белка t (1; 19) в пре-B ALL. Cell 1990, 60: 547-555.

    4.Nourse J, Mellentin JD, Galili N, Wilkinson J, Stanbridge E, Smith SD, Cleary ML: хромосомная транслокация t (1; 19) приводит к синтезу слитой гомеобоксовой мРНК, которая кодирует потенциальный химерный фактор транскрипции. Cell 1990, 60: 535-545.

    5. Моника К., Галили Н., Норс Дж., Салтман Д., Клири М.Л.: PBX2 и PBX3, новые гены гомеобокса с обширной гомологией с протоонкогеном человека PBX1. Mol Cell Biol 1991, 11: 6149-6157.

    Wagner K, Mincheva A, Korn B, Lichter P, Popperl H: Pbx4, новый член семейства Pbx на хромосоме 8 мыши, экспрессируется во время сперматогенеза.Mech Dev 2001, 103: 127-131.

    Milech N, Kees UR, Watt PM: Новые альтернативные изоформы PBX3 в лейкозных клетках с различными специфичностями взаимодействия. Гены хромосом рака 2001, 32: 275-280.

    Di GG, Koss M, Capellini TD, Brendolan A, Popperl H, Selleri L: Пространственно-временная экспрессия Pbx3 во время органогенеза у мышей. Гены Expr Patterns 2006, 6: 747-757.

    Lichtenauer UD, Duchniewicz M, Kolanczyk M, Hoeflich A, Hahner S, Else T, Bicknell AB, Zemojtel T, Stallings NR, Schulte DM и др .: Фактор транскрипции пре-B-клеток 1 и стероидогенный фактор 1 синергетически регулируют рост коры надпочечников и стероидогенез.Эндокринология 2007, 148: 693-704.

    Ого A, Waterman MR, McAllister JM, Kagawa N: гомеодоменный белок Pbx1 участвует в цАМФ-зависимой транскрипции человеческого CYP17. Arch Biochem Biophys 1997, 348: 226-231. Грегори PA, Mackenzie PI: Комплекс гомеодомена Pbx2-Prep1 модулирует опосредованную ядерным фактором 1-альфа гепатоцитов активацию гена UDP-глюкуронозилтрансферазы 2B17. Mol Pharmacol 2002, 62: 154-161. Rhee JW, Arata A, Selleri L, Jacobs Y, Arata S, Onimaru H, Cleary ML: Дефицит Pbx3 приводит к центральной гиповентиляции.Am J Pathol 2004, 165: 1343-1350.

    Qiu Y, Tomita Y, Zhang B, Nakamichi I, Morii E, Aozasa K: Фактор транскрипции 1 пре-B-клеточного лейкоза регулирует экспрессию валозин-содержащего белка, гена, участвующего в росте рака. Ам Дж. Патол 2007, 170: 152-159. Морган Р., Плаурайт Л., Харрингтон К.Дж., Майкл А., Панда Х.С.: Нацеливание на факторы транскрипции HOX и PBX при раке яичников. BMC Cancer 2010, 10:89.

    Shears L, Plowright L, Harrington K, Pandha HS, Morgan R: Нарушение взаимодействия между HOX и PBX вызывает некротическую и апоптотическую гибель клеток в линиях рака почки CaKi-2 и 769-P.Дж. Урол 2008, 180: 2196-2201.

    Plowright L, Harrington KJ, Pandha HS, Morgan R: Факторы транскрипции HOX являются потенциальными терапевтическими мишенями при немелкоклеточном раке легкого (нацеленные на гены HOX при раке легкого). Br J Cancer 2009, 100: 470-475. Aulisa L, Forraz N, McGuckin C, Hartgerink JD: Ингибирование пролиферации раковых клеток с помощью сконструированных пептидных амфифилов. Acta Biomater 2009, 5: 842-853.

    Enright AJ, John B, Gaul U, Tuschl T, Sander C, Marks DS: цели MicroRNA

    у дрозофилы.Genome Biol 2003, 5: R1.

    Lewis BP, Burge CB, Bartel DP: Консервативное спаривание семян, часто фланкированное аденозинами, указывает на то, что тысячи генов человека являются мишенями для микроРНК. Cell 2005, 120: 15-20.

    Крек А., Грун Д., Пой М.Н., Вольф Р., Розенберг Л., Эпштейн Э.Дж., Макменамин П., да П, Гунсалус К.С., Стоффель М. и др.: Комбинаторная мишень микроРНК

    прогноза. Нат Генет 2005, 37: 495-500.

    Кикугава Т., Кинугаса Ю., Сираиси К., Нанба Д., Накаширо К., Танджи Н., Йокояма М., Хигасияма С. PLZF регулирует транскрипцию Pbx1, а комплекс Pbx1-HoxC8 приводит к андроген-независимой пролиферации рака простаты.Простата 2006, 66: 1092-1099.

    Shiraishi K, Yamasaki K, Nanba D, Inoue H, Hanakawa Y, Shirakata Y, Hashimoto K, Higashiyama S: Фактор транскрипции 1 пре-B-клеточного лейкоза является основной мишенью для подавления роста клеток меланомы, опосредованного цинковыми пальцами промиелоцитарного лейкоза . Онкоген 2007, 26: 339-348. Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Игнатьева Е.В., Ананко Е.А., Подколодная О.А., Колпаков Ф.А. и др.: Базы данных по регуляции транскрипции: TRANSFAC, TRRD и COMPEL.Nucleic Acids Res 1998, 26: 362-367.

    Knoepfler PS, Calvo KR, Chen H, Antonarakis SE, Kamps MP: Meis1 и pKnox1 связывают ДНК кооперативно с Pbx1, используя поверхность взаимодействия, нарушенную онкопротеином E2a-Pbx1. Proc Natl Acad Sci USA 1997, 94: 14553-14558.

    Qin P, Haberbusch JM, Zhang Z, Soprano KJ, Soprano DR: Белки фактора транскрипции пре-B-клеточного лейкоза (PBX) являются важными медиаторами для зависимой от ретиноевой кислоты энтодермальной и нейрональной дифференцировки клеток эмбриональной карциномы мыши P19.J Biol Chem 2004, 279: 16263-16271.

    Литвинов И.В., Вандер Гринд DJ, Сюй Й., Энтони Л., Далримпл С.Л., Айзекс Дж. Т.: Определенная среда с низким содержанием кальция, не содержащая сыворотки, выбирает для роста нормальных эпителиальных стволовых клеток предстательной железы. Cancer Res 2006, 66: 8598-8607.

    Foradori CD, Weiser MJ, Handa RJ: Негеномные действия андрогенов.

    Front Neuroendocrinol 2008, 29: 169-181.

    Boyerinas B, Park SM, Hau A, Murmann AE, Peter ME: Роль let-7 в дифференцировке клеток и раке.Endocr Relat Cancer 2010, 17: F19-F36. Porkka KP, Pfeiffer MJ, Waltering KK, Vessella RL, Tammela TL, Visakorpi T: профилирование экспрессии микроРНК при раке простаты. Cancer Res 2007, 67: 6130-6135.

    Озен М., Крейтон С.Дж., Оздемир М., Иттманн М.: Широко распространенная дерегуляция экспрессии микроРНК при раке простаты человека. Онкоген 2008, 27: 1788-1793.

    Ambs S, Prueitt RL, Yi M, Hudson RS, Howe TM, Petrocca F, Wallace TA, Liu CG, Volinia S, Calin GA и др.: Геномное профилирование микроРНК и матричной РНК выявляет дерегулированную экспрессию микроРНК при раке простаты.Cancer Res 2008, 68: 6162-6170.

    Тонг А.В., Фулхэм П., Джей С., Чен П., Халил И., Лю С., Сензер Н., Эклунд А.С., Хан Дж., Немунайтис Дж .: Анализ профиля микроРНК рака простаты человека. Cancer Gene Ther 2009, 16: 206-216.

    Коппола В., Де М.Р., Бончи Д.: МикроРНК и рак простаты. Endocr Relat Cancer 2010, 17: F1-17.

    Ribas J, Ni X, Haffner M, Wentzel EA, Salmasi AH, Chowdhury WH, Kudrolli TA, Yegnasubramanian S, Luo J, Rodriguez R, et al: miR-21: регулируемая рецептором андрогена микроРНК, которая способствует гормонозависимой и гормононезависимый рост рака простаты.Cancer Res 2009, 69: 7165-7169.

    Dong Q, Meng P, Wang T, Qin W, Qin W, Wang F, Yuan J, Chen Z, Yang A, Wang H: MicroRNA let-7a подавляет пролиферацию клеток рака предстательной железы человека in vitro и in vivo путем нацеливания на E2F2 и CCND2. PLoS One 2010, 5: e10147.

    Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, Iorio M, Roldo C, Ferracin M и др.: Сигнатура экспрессии микроРНК солидных опухолей человека определяет мишени раковых генов.Proc Natl Acad Sci USA

    2006, 103: 2257-2261.

    Crijns AP, de GP, Geerts D, Ten Hoor KA, Hollema H, van der ST, Hofstra RM, de Bock GH, de JS, van der Zee AG и др.: Белки гомеобокса MEIS и PBX при раке яичников. Eur J Cancer 2007, 43: 2495-2505.

    DOI: 10.1186 / 1476-4598-10-50

    Цитируйте эту статью как: Ramberg et al .: Регулирование экспрессии PBX3 андрогеном и Let-7d при раке простаты. Молекулярный рак 2011 10:50.

    Отправьте следующую рукопись в BioMed Central и воспользуйтесь всеми преимуществами:

    • Удобная онлайн-подача

    • Тщательная экспертная оценка

    • Отсутствие ограниченного пространства или платы за цветные рисунки

    • Немедленная публикация о приемке

    • Включение в PubMed, CAS, Scopus и Google Scholar

    • Исследование, свободно распространяемое

    Разместите рукопись на сайте www.

    Leave a Reply

    Ваш адрес email не будет опубликован. Обязательные поля помечены *